Abstract
Deciphering the post-transcriptional mechanisms (PTM) regulating gene
expression is critical to understand the dynamics underlying
transcriptomic regulation in cancer. Alternative polyadenylation
(APA)—regulation of mRNA 3′UTR length by alternating poly(A) site
usage—is a key PTM mechanism whose comprehensive analysis in cancer
remains an important open challenge. Here we use a method and analysis
pipeline that sequences 3′end-enriched RNA directly to overcome the
saturation limitation of traditional 5′–3′ based sequencing. We
comprehensively map the APA landscape in lung cancer in a cohort of 98
tumor/non-involved tissues derived from European American and African
American patients. We identify a global shortening of 3′UTR transcripts
in lung cancer, with notable functional implications on the expression
of both coding and noncoding genes. We find that APA of non-coding RNA
transcripts (long non-coding RNAs and microRNAs) is a recurrent event
in lung cancer and discover that the selection of alternative polyA
sites is a form of non-coding RNA expression control. Our results
indicate that mRNA transcripts from EAs are two times more likely than
AAs to undergo APA in lung cancer. Taken together, our findings
comprehensively map and identify the important functional role of
alternative polyadenylation in determining transcriptomic heterogeneity
in lung cancer.
Subject terms: Lung cancer, Transcriptomics
__________________________________________________________________
Alternative polyadenylation (APA) regulates the length of the 3′UTR of
mRNA. Here, the authors describe a method to accurately measure APA in
tumours and apply this method to investigate the differences in APA in
African American and European American lung cancer samples.
Introduction
Precision medicine in cancer management often relies on the use of
biomarkers to classify molecular subtypes and stratify responder and
non-responder patients. However, transcriptomic-based signatures can be
confounded by molecular intratumor heterogeneity, as found in multiple
cancer types^[50]1–[51]3, including lung cancer^[52]4, which is the
leading cause of cancer-related death in the United States^[53]5.
Post-transcriptional modification (PTM) is a major contributor to
transcriptomic heterogeneity. Global regulation of PTM is evident in
many immune cells, including T-cells, where it is involved in cell
proliferation, differentiation, and response to extracellular
stress^[54]6. Tumor cells can also rewire the transcriptome via PTM
making it important to understand the dynamics underlying
transcriptomic regulation in cancer cells.
Almost all eukaryotic mRNAs undergo polyadenylation, a nuclear process
that involves the addition of non-templated adenosines to the 3′ end of
transcripts. Approximately 70% of human genes contain more than one
polyadenylation site (polyA site, PAS). The use of different or
alternate PAS is called alternative polyadenylation (APA). APA is a key
PTM mechanism regulating nuclear export, stability, and translational
efficiency of mature mRNAs^[55]7–[56]10 and leads to multiple forms of
the transcript with different 3′ untranslated region (UTR)
lengths^[57]10–[58]12. This A/U rich 3′ UTR is a prominent docking site
for RNA regulatory elements, including miRNAs and RNA binding proteins
such as Hu-Antigen R (HuR), also known as ELAV like RNA binding
protein-1 (ELAV1), through which it regulates transcript stability,
transcript export, and cellular localization and protein
translation^[59]13–[60]15. Further, DNA-encoded SNPs located in the
mRNA 3′UTR may not be functional anymore if 3′UTR length is
shortened^[61]16.
The selection of a polyA site is a dynamic process that contributes to
both normal physiology and pathological
phenotypes^[62]10,[63]11,[64]17–[65]20. For instance, during B-cell
differentiation, the use of an intronic PAS generates a secreted form
of the IgM protein while the use of a distal site on the IgM transcript
generates a membrane-bound form^[66]17. Furthermore, an inherited
mutation that drives the use of a proximal polyA site in the TNSFRS2
gene—which encodes the cytokine BAFF—leads to increased BAFF expression
and susceptibility to autoimmune diseases^[67]20. Dysregulated APA is
also linked with cancer. Sandberg and Mayr independently demonstrated a
relationship between APA with proliferation and with
carcinogenesis^[68]11,[69]21, with recent studies highlighting global
shortening of 3′UTR as a characteristic of the cancer
transcriptome^[70]11,[71]21.
Although a few studies have assessed APA in lung cancer, they relied on
conventional methods largely based on 5′–3′ RNA-seq data. This approach
can lead to saturation^[72]22–[73]24 as the proportion of final reads
from a polyA transcript/fragment using either polyA selected RNA-seq or
total RNA-seq can be very low^[74]25–[75]27. This underscores the need
to comprehensively and specifically map polyA sites and APA in cancer
with a method that overcomes this saturation. Since we previously
observed that lung tumors derived from European Americans (EAs) are
enriched in cell proliferation and cell cycle pathways compared with
African American (AAs)^[76]28, we designed our study to investigate
whether differences in APA between the two populations exist. Here,
using 3′end-enriched RNA and direct mapping of polyA sites, in contrast
to traditional 5′–3′ sequencing methods, we identify dynamic APA events
and increase both the depth and accuracy of the analysis. We find that
lung cancer cells are significantly more likely to produce mRNA
transcripts with shorter 3′UTRs than normal cells and that these
shorter transcripts are related to poor patient survival. In this study
we show that global shortening of 3′UTR transcripts is present in lung
cancer, selection of alternative polyA sites in both long non-coding
and microRNA is a form of non-coding RNA expression regulation, and
mRNA transcripts from EA are two-fold more likely than AA to undergo
APA in lung cancer.
Results
Identification, quantification, and validation of polyA sites (PAS)
The 3′UTR-seq method generated a nucleotide-level resolution map of how
cells use distinct polyA sites in mRNA transcripts in lung cancer. We
identified 123,475 PAS, of which 102,005 were annotated to known genes
(Ensembl v90). To validate detected PAS, we compared our data with
known polyA databases where our data mapped to 79% and 86% of the
Derti^[77]29 and Gruber^[78]30 databases, respectively (Fig. [79]1a),
indicating that our analysis compared well with previously published
data and thus ensuring the quality. We next used External RNA Controls
Consortium (ERCC) spike-in RNAs to evaluate diagnostic performance,
limit of detection of ratio estimates, and expression ratio
variability. All aspects of our experiment’s technical performance
passed these quality control measures (Supplementary Fig. [80]1).
Following several detailed filtering steps (see “Methods” section),
37,037 polyA sites annotated to 17,220 genes remained. Of those 17,220
genes, 7870 (46%) had more than one polyA site (Supplementary
Data [81]1) (Fig. [82]1b), which is lower than the 70% reported by
other studies and is likely due to the stringent filtering approach we
applied. Although the majority (79%) of distal sites were within the
3′UTR as expected, only half of the proximal polyA sites were, with the
rest in introns (35%) or exons (12%) (Fig. [83]1c).
Fig. 1. Identification, quantification, and validation of poly (A) sites from
QuantSeq.
[84]Fig. 1
[85]Open in a new tab
a Overlap of polyA sites (y axis) with previously published databases
(Gruber et al.^[86]69 [[87]https://www.ncbi.nlm.nih.gov/sra/docs/]
SRP065825 and Derti et al. ^[88]29
[[89]https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE30198])
assuring a high quality. Percentages in the legend are reported with
spacing −5 to +5 nucleotides around identified PAS. b Detected
polyadenylation sites across genes: 37,037 poly (A) sites annotated to
17,220 genes, 46% of genes possess more than 1 site (green bars). c
Distribution of proximal and distal site location within the gene.
Characterization and classification of polyA sites in lung cancer
To examine the functional status of polyA sites in lung cancer, we
focused on the 7,870 genes for which we identified multiple polyA
sites. Of these, 3,531 genes (44%) had statistically significant
changes (switches) in polyA site usage between tumor and adjacent
non-involved tissue; 3,119 had enhanced proximal site usage and 412 had
enhanced distal site usage in tumor relative to adjacent non-involved
tissue (Fig. [90]2a, b and Supplementary Data [91]2–[92]4). Thus,
consistent with other tumor types^[93]21,[94]31, mRNAs are
significantly more likely to produce transcripts with shorter 3′UTRs
compared with non-transformed cells.
Fig. 2. Role of alternative polyadenylation in shaping the molecular and
clinical features of lung cancer.
[95]Fig. 2
[96]Open in a new tab
a Global shortening of 3′UTR detected by DexSeq2 analysis. The dot plot
map shows genes undergoing significant 3′UTR shortening (red) or
significant 3′UTR lengthening (blue) and no changes (gray) in tumors
compared with adjacent non-involved tissues. Each dot corresponds to a
gene. b Genomic location of regulated proximal and distal sites in
tumors. c Breakdown of regulated sites by sense/anti-sense strands. d
Expression of polyadenylation-related genes in tumor and adjacent
non-involved tissues. Heatmap of combined z-score and gene expression
analysis of 29 known polyadenylation factors in tumors compared to
non-involved tissues. The asterisk indicates the degree of significance
of differentially expressed genes. e Enriched pathways. Pathway
significantly enriched have a −log10 (p-value) greater than 1.3
(p-value < 0.05; Fisher’s exact test; one-tailed test). Ingenuity
canonical pathways analysis in genes with enhanced proximal and distal
sites. f Relationship between 3′UTR shortening and lung cancer
survival. A two-sided log-rank test is used to compare the survival
times between two groups. The p‐value of the log‐rank test statistic is
commonly approximated by the chi‐square distribution and thus only
approximate in a higher limit. *p < 0.05; **p < 0.01; ***p < 0.001;
****p < 0.0001.
Of the 3,119 transcripts with enhanced use of proximal PAS in tumor
compared with adjacent non-involved tissues, 1,549 were same-exon, 903
were composite-exon and 667 were skipped-exon pair types. In contrast,
among the 412 genes with significantly increased usage of distal sites,
81 were same-exon, while 233 and 98 were composite-exon and
skipped-exon, respectively (Supplementary Data [97]2 and [98]3). These
results are consistent with previous studies indicating that a switch
in the usage of proximal polyA sites in cancer involves predominantly
same-exon sites^[99]31. Many proximal polyA sites with increased use in
tumor tissues were located in intronic (n = 925) and exonic (n = 301)
regions (Supplementary Data [100]4) suggesting that use of these sites
could lead to truncated proteins with different amino acid sequences
and/or function. There was no enrichment in sense or anti-sense
transcripts among regulated APA sites (Fig. [101]2c).
For each gene, we also defined a measure of shortening, the polyA site
index (PSI), which is a ratio of read number from a proximal site
divided by the total number of reads from proximal and distal sites.
The ΔPSI captures the relative use of proximal sites compared with
distal sites in tumor cells compared to non-involved tissues and
confirms that 3′UTR lengths are globally shortened in lung cancer cells
(Supplementary Data [102]5) (Supplementary Fig. [103]2a). Using
genome-wide RNA-seq reads from the Quantseq output (see “Methods”
section), we observed that expression of key genes involved in the
regulation of polyadenylation, including CPSF and CSTF, were
upregulated in tumors compared with non-involved lung tissues
suggesting a possible mechanism of 3′UTR mRNA shortening
(Fig. [104]2d).
Although we observed some differences in the specific transcripts
undergoing 3′UTR shortening in lung adenocarcinoma (LUAD) and lung
squamous cell carcinoma (LUSC) (Supplementary Data [105]6)
(Supplementary Fig. [106]2b), overall, 3′UTR length was similar between
LUAD and LUSC (Supplementary Fig. [107]2c).
Molecular and clinical features of lung cancer associated with APA
To characterize the pathways that are targeted by APA in lung cancer,
we performed a pathway enrichment analysis using IPA^[108]32 and found
those mRNA transcripts with shorter 3′UTRs were enriched with cell
cycle/proliferation pathways often dysregulated in cancer, including
mTOR and its target ubiquitin proteolysis pathway, receptor tyrosine
kinase signaling and signaling specific to lung cancer. The mTOR
finding is consistent with recent evidence identifying activation of
the mTOR pathway as a driver of APA in cancer^[109]33. Transcripts with
longer 3′UTRs were generally enriched in metabolism and p53
signaling-related pathways (Fig. [110]2e and Supplementary Data [111]7)
collectively suggesting that APA contributes to the molecular features
of lung cancer.
Stress and exposure to various environmental factors can modulate
APA^[112]34,[113]35, therefore we asked whether exposure to tobacco
could modulate APA in lung cancer. We compared genes with regulated
polyA sites in tumor tissue only between current and former smokers but
did not detect any significant changes (Supplementary Fig. [114]3)
suggesting that smoking is not a major driver of APA events in lung
cancer.
As cancer cells favor the selection of shorter 3′UTRs, we reasoned that
the trimming of mRNA transcripts could be a prognostic biomarker. To
determine whether APA captures genes with clinical relevance, we
performed a multivariate Cox regression correcting for patient age,
sex, race, and tumor stage for each gene and identified a strong
prognostic signature based on the APA usage pattern of 12 genes in lung
cancer (Fig. [115]2f and Supplementary Data [116]8), including the type
I transmembrane glycoprotein immunoglobulin CD96 and a key homologous
recombination repair gene POLA2. Further, gene ontology analysis of APA
events associated with survival revealed enrichment of cellular
metabolic processes (Supplementary Data [117]9).
Genes with 3′ shortening have a higher concordance between mRNA and protein
levels
When a miRNA engages with its cognate miRNA binding site, it can induce
message degradation or destabilization. Thus, escape from miRNA
repression can result in a more stable transcript with a longer
half-life and relative higher abundance of the mRNA and resulting in
more protein^[118]11,[119]21. Alternatively, mRNA levels are not always
affected given that most miRNA/mRNA binding interactions are imperfect
and do not lead to mRNA degradation. Lastly, the competing-endogenous
(ceRNA) hypothesis argues that, rather than affecting mRNA expression
in cis, APA impacts mRNA in trans by altering the stochastic nature by
which the loss of one miRNA binding site frees up miRNAs to bind to
other targets^[120]14,[121]19–[122]21,[123]36,[124]37. To test these
hypotheses in lung cancer, we first found that among genes with
significant 3′UTR shortening, there was an average loss of nine miRNA
binding sites per gene (range 1–51), with enrichment for lung
cancer-associated miR-124, miR-181, let-7, and miR-27 binding sites
(Supplementary Fig. [125]4a, b and Supplementary Data [126]10,
[127]11). We calculated a gene-wise correlation between PSI and
expression and found that the PSI of 1,376 of the 3,531 genes
significantly correlates with expression (Supplementary Data [128]12),
roughly evenly split between positive and negative associations. We
then asked, what is the probability of observing this number of genes
(N = 1,376) or greater by chance. To test this, we shuffled the APA
matrix 10,000 times and calculated an empirical significance (p < 0.17)
by counting the number of times the genes with Spearman Rho > 0.1 are
greater than or equal to 1,376.
To test whether APA could drive a higher concordance between
mRNA-protein levels for genes with shorter 3′UTRs, we mined cancer cell
line encyclopedia (CCLE) proteomics and RNA-seq data^[129]38. Using
RNA-seq reads, we inferred the PSI as before^[130]24 and found that
genes with higher median PSI (more shortening) have a stronger
correlation between their mRNA and protein (top 10% vs bottom 10% genes
ranked by median PSI, Wilcoxon rank-sum p = 0.027) (Supplementary
Data [131]13 and Supplementary Fig. [132]5). We replicated this
observation at a tumor tissue level using TCGA^[133]39 and CPTAC
data^[134]40,[135]41 where mRNA levels and protein abundance for the
same samples are available [see “Methods” section] (Wilcoxon rank-sum
p = 0.03 [breast] and p = 0.075 [lung]) (Supplementary Data [136]13 and
Supplementary Fig. [137]5). These data suggest that the tighter
correlation between mRNA and protein found in both cell lines and tumor
tissues is, at least partially, due to 3′UTR mRNA shortening in cancer
cells.
Identification of recurrent cancer-related APA events in non-coding RNAs
Given the evidence that non-coding RNAs also undergo polyadenylation,
we proposed, and subsequently identified, significant APA events in
non-coding RNAs. Overall, 955 (12%) of the transcripts with more than
one PAS in our analysis mapped to a non-coding RNA (Supplementary
Data [138]4). Of the 27 miRNA host genes detected by our sequencing
method and that passed the read count threshold, 14 had more than one
PAS and, of these, 10 (71%) underwent significant alternative
polyadenylation in lung cancer, including miR-155 and let-7B
(Supplementary Data [139]4). Furthermore, our method detected 928 long
non-coding RNAs, of which 231 had more than one polyA site. Of these,
57 (25%) underwent alternative polyadenylation in lung cancer,
including DLEU1, LINC01138, and PVT1 (Supplementary Data [140]4).
To test whether APA of non-coding transcripts modulates expression, we
generated corresponding total RNA-seq data and small RNA-seq data for
39 tumor/non-involved tissue pairs where we had sufficient tissue and
compared the average difference in tumor and adjacent non-involved PSI
to the average difference in tumor and adjacent non-involved miRNA
expression. Of the 10 miRNA host genes that underwent recurrent APA in
lung cancer, two (miR-3936, miR-646) did not have mapped reads in the
small RNA-seq file. Of the remaining eight, host miRNA APA was
correlated with the expression of the individual miRNAs residing within
the host gene (Fig. [141]3a and Supplementary Data [142]14).
Interestingly, cancer-related APA can have a bi-directional effect on
mature miRNA expression. For example, decreased use of a proximal polyA
site on the miR17HG transcript, which includes miR-17, miR-18a,
miR-19a, miR-19b, and miR-92a, is associated with increased mature
miRNA expression in tumors compared with adjacent non-involved tissues
(Fig. [143]3a). However, in LET7BHG and miR-155, increased use of a
distal polyA site is associated with decreased mature let-7b expression
in tumors compared with adjacent non-involved tissue. We also analyzed
the impact of APA on isomiR expression and observed similar trends
(Supplementary Data [144]14). Several of the long non-coding RNAs that
underwent APA in lung cancer, including DLEU1 and PVT1 which are
associated with lung cancer survival^[145]42, also correlated with
expression (Fig. [146]3b and Supplementary Data [147]15). We also
tested the performance of the prognostic index separately in EAs and
AAs and computed the hazard ratio (HR) for each population separately
(AA HR = 4.1, p < 0.001; EA HR = 4.3, p < 0.001).
Fig. 3. Alternative polyadenylation of non-coding RNAs in lung cancer and
relationship with expression in microRNAs long non-coding RNAs.
[148]Fig. 3
[149]Open in a new tab
a Panels show the correlation between the average 3′UTR length
difference in tumor and adjacent non-involved tissues (PSI) to the
average miRNA expression difference in tumor and adjacent non-involved
tissues. In the scatter plot, the y axis denotes the delta PSI and the
x axis denotes delta miRNA. b Panels show the correlation between the
average 3′UTR length difference to the average long non-coding RNA
expression difference in tumor and adjacent non-involved tissues. In
the scatter plot, the y axis denotes the delta PSI and the x axis
denotes delta long-non-coding RNA. c Difference in HuR/ELAV1 binding to
mRNA segments gained and lost through APA based on RNA
immunoprecipitation (RIP-seq) assays profile measuring ELAV1/HuR RNA
binding of K562 leukemia cells and normal GM12878 cells as a control
from [150]GSE35585. For a given gene or element, ELAV1/HuR binding is
quantified by counting the number of reads between primary proximal and
distal polyA site of usage in both cell lines individually. Here in the
box plot, the lower and upper hinges of the boxes correspond to the
25th and 75th percentiles and the whiskers represent the 1.5×
inter-quartile range (IQR) extending from the hinges. The center lines
denote the median and the black line represents the rest of the
distribution, except for the points that are determined to be
“outliers”. A two-tailed Wilcoxon rank-sum test is used to compute the
significance of the difference between medians. The p-values are below
the minimum floating integer that can be computed using standard R and
thus the exact value reported by R is 0. Thus, we provide the
approximate upper bound reported by R.
Interestingly, the regions of these non-coding transcripts that were
retained or lost due to APA in cancer cells frequently overlapped with
HuR/ELAV1 binding regions. Further, by mining RIP-seq data we observed
significant differential binding between HuR to the regions retained or
lost through APA in both long non-coding RNAs and microRNAs
(Fig. [151]3c). As HuR modulates transcripts—through both
stabilization^[152]43 and destabilization^[153]44, gain or loss of RNA
bindings proteins is a potential mechanism by which APA of non-coding
RNAs controls expression of mature transcripts. For example, increased
use of a distal polyA site on the miR17HG RNA transcript relative to a
proximal one (Supplementary Data [154]4) leads to the inclusion of a
region with multiple binding sites for HuR proteins in tumor tissues
(Fig. [155]3a). Indeed, our data show that there is more HuR binding to
this region in cancer, compared with normal cell lines (Fig. [156]3c).
As the PSI correlates with increased miR-17 cluster expression, we
speculate that this HuR binding leads to greater transcript
stabilization, greater processing, and, therefore, higher expression.
Collectively, these data suggest that APA of non-coding RNA transcripts
is a recurrent event in lung cancer and that the selection of
alternative polyA sites could be a form of non-coding RNA expression
control.
Population differences 3′UTR length
In a previous transcriptomic analysis of lung cancer in European
Americans and African Americans, we observed that genes dysregulated in
tumors from EAs only are enriched in cell proliferation and cell cycle
pathways compared with AAs^[157]28. Given that proliferating cells are
more likely to have shorter 3′UTRs^[158]11, we tested the hypothesis
that lung tumors from EAs would be enriched in regulated gene-level APA
events and have global shorter 3′UTRs compared with AAs. When compared
with non-involved adjacent tissues, tumor cells from EAs had more
significant APA events compared with AAs (Fig. [159]4a). Specifically,
of genes with more than one APA site, 30% of genes (2,276) undergo
3′UTR shortening in EAs compared with 17% (1,360) in AAs, following
Benjamini-Hochberg FDR-adjusted p-values for each site. This represents
a greater than 2-fold increase of APA events in EAs (Supplementary
Data [160]16 and [161]17). We repeated this analysis, comparing the
gene-wise number of APA events (log2PSI value) in tumor vs non-involved
adjacent tissues in both EAs and AAs using a multivariate regression
correcting for patient age, sex, tumor stage, and smoking status and
consistently found a 2-fold higher number of genes going through APA
events in EAs vs AAs. There was no specific enrichment in LUSC vs. LUAD
(Supplementary Fig [162]2d).
Fig. 4. Race-related differences in global 3′UTR length of genes across
multiple cancer types.
[163]Fig. 4
[164]Open in a new tab
a Distribution of shortening (red) and lengthening (blue) events in
lung cancer in EAs and AAs. b Pan-cancer population differences
shortening (red) and lengthening (blue) events in EAs and AAs. c
Comparison of PSI in EAs and AAs in tumor tissues in TCGA. First,
cancer types are categorized by cell type or tissue of origin, if
possible, where defined groups are pan-squamous (squamous cell-derived
tumors), pan-adeno (glandular structures in epithelial tissue derived
tumors), pan-kidney (tumors originating in the kidney), and rest
(referring to cancer types that cannot be categorized and include LAML,
THYM, GBM, LGG, SARC, BRCA, LIHC, OV, TCGT, THCA, and UCEC; refer here
for reference to each cancer type:
[165]https://gdc.cancer.gov/resources-tcga-users/tcga-code-tables/tcga-
study-abbreviations). Second, additional categorization was performed
based on tissue type (where solid is derived from solid tumors and
neural-crest and Hema & Lymph—hematologic and lymphatic tumors). A
two-sided Wilcoxon Rank-sum test has been performed within each cancer
type and significance before multiple testing correction is provided.
LAML p = 0.55; THYM p = 0.92; GBM p = 0.55; SARC p = 0.15; LUAD
p = 0.64; PAAD p = 0.79; PRAD p = 0.42; STAD p = 0.11; KIRC p = 0.069;
KIRP p = 0.756; BLCA p = 0.332; CESC p = 0.816; ESCA p = 0.031; HSNC
p = 0.977; LUSC p = 0.703; LUSC p = 0.703; BRCA p = 0.00011; LIHC
p = 0.14103; OV p = 0.14827; TGCT p = 0.65657; THCA p = 0.70424; UCEC
p = 0.73852. Here in the box plot, the lower and upper hinges of the
boxes correspond to the 25th and 75th percentiles and the whiskers
represent the 1.5× inter-quartile range (IQR) extending from the
hinges. The center lines denote the median and the black line
represents the rest of the distribution, except for the points that are
determined to be “outliers”. A two-sided Wilcoxon rank-sum test is used
to compute the significance of the difference between medians.
As no other large cancer datasets with 3′UTR-specific sequencing exist
to our knowledge, we mined TCGA 5′–3′ RNA-seq reads from non-small cell
lung cancer^[166]24 to test whether EAs have more global 3′UTR
shortening compared with AAs. We calculated a PSI^[167]24 for each gene
and using a similar multivariate regression above, tested the
association between PSI and race correcting for sex, tumor stage, and
age of the patient (this analysis was done in tumors only as there were
not sufficient adjacent non-involved samples from AA patients for
comparison to EAs). We confirmed that while more genes undergo
shortening in EA tumors in comparison to AA tumors from LUSC
(EA = 1,254 compared with AA = 598) and LUAD (EA = 1,443 compared with
AA 1,075) (Supplementary Fig. [168]6b), the global difference in 3′UTR
length, considering tumor tissue only, is not significantly different
(Fig. [169]4c). To test pan-cancer population differences in APA, we
next mined the same data set for 11,265 TCGA samples from 28 cancer
types for 7,062 genes^[170]45. Again, we modeled the PSI index as a
function of race correcting for cancer type, sex, tumor stage, and age
of the patient. Consistently, we found a higher number of genes with
3′UTR shortening in EA tumors compared with AA tumors in pan-cancer (in
EA = 1,643 compared to in AA = 1,277) (Fig. [171]4b). Some of the
strongest differences were observed in breast (p = 0.0001) and
esophageal cancer (p = 0.031), where global shortening of mRNA
transcripts was also observed (Fig. [172]4c) (Supplementary
Data [173]18).
As demonstrated earlier (Fig. [174]2d), there is global dysregulation
of proteins involved with APA in cancer, i.e., the PA machinery. To
determine whether the population differences in APA are related to
differential activity of PA machinery between EA and AA tumors, we
computed an PA machinery activity score (median scaled expression of PA
machinery genes and found it to be positively correlated with PSI-load
(Rho = 0.18, p < 2E−16)), suggesting that expression of
machinery-related genes modulates global APA changes. We then computed
the difference in the PA machinery activity score by race in each
cancer type in TCGA and observed a significantly higher activity in
BRCA tumors from EAs compared with AAs (Supplementary Fig. [175]6c and
Supplementary Data [176]19), suggesting that population differences in
APA could be driven by population differences in PA-related machinery
gene expression.
We next asked what the underlying genetic basis behind these PSI
differences could be. We firstly reasoned that if there is a genetic
cause, it is likely to be somatic as we did not observe significant
differences in APA in non-involved tissues between EAs and AAs. Testing
this hypothesis, we examined the relationship between somatic mutations
in driver genes (682 driver genes census set derived from COSMIC
[[177]https://cancer.sanger.ac.uk/census]) with the 3′UTR shortening
index in TCGA pan-cancer samples (Fig. [178]5 and Supplementary
Data [179]20). The top genes whose mutation status are significantly
associated (FDR p < 0.1) with the 3′UTR shortening index after FDR
correction are RB1 (FC = 1.1, Wilcoxon rank-sum raw p < 2.6E−05), ACSL3
(FC = 1.39, Wilcoxon rank-sum p < 0.0001), ERCC5 (FC = 1.32, Wilcoxon
rank-sum p < 0.0002), PD-L1 (FC = 1.31, Wilcoxon rank-sum p < 0.0004),
FANCC (FC = 1.17, Wilcoxon rank-sum p < 0.0004), and NTRK1 (FC = 1.21,
Wilcoxon rank-sum p < 0.0006). As the occurrence of these mutations is
not shown to vary by population, we further reason that somatic
mutations are not driving the population differences in APA that we
describe. This observation is also consistent with Xia et al. ^[180]24.
Fig. 5. Ratio of 3′UTR shortening index (PSI index) in tumors with driver
gene mutated vs. wildtype status from TCGA.
[181]Fig. 5
[182]Open in a new tab
The ratio of median PSI-load index (fold change [FC], x axis) between
driver gene mutated vs. wildtype tumors (pan-cancer) derived from TCGA
for 683 cancer driver genes (COSMIC) and corresponding p-value of
Wilcoxon rank-sum test are shown. The red points are significant
(FDR < 0.1) past the FC threshold of FC > 0.1 and are labeled with
their HGNC gene names.
Discussion
Our study uses both a specific 3′UTR sequencing method that allows
simultaneous genome-wide polyA site identification and an analysis
pipeline tailored to detect significantly regulated APA sites in lung
cancer. Charting the comparative regulation of polyA sites in lung
cancer, we identify a global shortening of mRNA transcripts in lung
tumor cells relative to non-transformed adjacent tissue. Almost 50% of
genes with more than one polyA site undergo alternative polyadenylation
in lung cancer to produce different transcript isoforms, implying a
high degree of transcriptional heterogeneity at the level of the 3′UTR
that is not usually captured in transcriptomic studies. The global and
gene-specific (DICER1, FGF2, TACC1, RAB10, RUNX1^[183]21, ZEB1, PDXK,
COL1A2, PPP3CB, C6orf89, SAP30L, APH1B, CHURC1^[184]31) shortening
observed in our study is consistent with previous findings in other
cancer types using different approaches^[185]21,[186]31,[187]46.
Pathway analyses suggest that cell proliferation and oncogenic
signaling pathways, including mTOR, are enriched with short transcript
isoforms in lung cancer. Intriguingly, the ubiquitin-mediated
proteolysis pathway, a major target of mTORC1, is significantly
enriched in the same direction. A recent study demonstrated that the
activation of the mTORC1 pathway is a potential driver of global 3′UTR
shortening in cancer^[188]33. Long isoforms are enriched with p53
signaling and metabolic-related pathways. These patterns are consistent
with several previous
observations^[189]11,[190]21,[191]40,[192]47–[193]49. Our results
suggest that the generation of shorter 3′UTR transcripts through APA
contributes to the molecular features of lung cancer, as evidenced by
the grouping of genes undergoing APA in lung cancer-related pathways.
The effect of APA on gene expression, not yet fully understood, is
debated and likely multi-modal. One hypothesis is that expression of a
shorter 3′UTR leads to increased mRNA^[194]50 or
protein^[195]19–[196]21 in cis, a type of gene amplification in the
absence of mutations or somatic alterations^[197]49. Our data indicate
that genes with short mRNA transcripts have a tighter correlation with
their respective protein products. This observation agrees with the
decrease in concordance between mRNA and protein abundance in some
tissues^[198]51,[199]52 and is consistent with studies showing a
stronger gene-wise mRNA/protein correlation in tumor cells than in
normal cells^[200]47. Others argue that the selection of short mRNA
3′UTRs through APA is enriched in transcripts predicted to act as
ceRNAs for tumor-suppressor genes^[201]14. These associations are also
complicated by the incomplete complementarity between miRNAs and mRNAs
in mammals and the presence of other RNA stability regions in 3′UTRs,
such as ALU elements. The latter also impacts the stability and
expression of a mRNA and which, equally to miRNAs, can be impacted by
3′UTR shortening^[202]53,[203]54. Further, as our data show, increased
use of a proximal APA site in tumor need not necessarily lie in the
3′UTR and there are many instances of increased proximal APA use
occurring in an intron or exon. This kind of APA may not impact RNA or
protein expression per se, but would almost surely impact the protein
type produced. Thus, the ultimate impact of APA on the transcriptome
and proteome is likely dependent on a multitude of factors.
Given recent evidence linking APA as a cellular stress response to
exogenous stimuli^[204]14,[205]35,[206]55, we hypothesized that smoking
could be a potential global regulator of APA in lung cancer. Our data
suggest that while smoking may contribute to the APA of a subset of
genes, it does not appear to be a global regulator. This conclusion is
consistent with other studies showing global shortening of 3′UTRs in
cancers not associated with smoking^[207]31.
The greater analysis depth of our sequencing method and study design
facilitated the identification of APA events. A key finding from our
study is that non-coding RNAs also undergo recurrent alternative
polyadenylation in lung cancer and that it is a common event. Moreover,
it seems to be a mechanism of long non-coding RNA expression, whereby
the retention or loss of RNA via APA modulates binding by HuR, and
likely, other RNA binding proteins as well. While previous work
demonstrated that both long non-coding RNAs and microRNA transcripts
undergo polyadenylation, and that alternative polyadenylation of lncRNA
transcripts was previously described^[208]22,[209]46,[210]56–[211]58,
our study demonstrates widespread APA of recurrent and clinically
relevant non-coding RNAs in cancer and may represent a form of
transcriptomic regulation for non-coding RNAs in cancer.
We also identified population differences in APA. On average, mRNA
transcripts from EAs were two times more likely that AAs to undergo APA
in lung cancer compared with non-involved tissues. However, we did not
find a globally shorter 3′UTR landscape in lung cancer in either our
own samples or in TCGA. As population differences in APA had not
previously been addressed to our knowledge, we leveraged the TCGA
database and observed significant global shortening of 3′UTRs among EAs
with breast cancer compared with AAs and an inverse trend in esophageal
cancer. We did not observe population differences in the use of
specific polyadenylation signal hexamers among regulated PAS
(Supplementary Fig. [212]6a). Previous studies have shown that most APA
events result from the dysregulated expression of proteins controlling
polyadenylation^[213]24. We and others^[214]18 observed overexpression
of key genes involved in the regulation of the polyadenylation (PA)
machinery, including CPSF and CSTF, in tumors compared with
non-involved lung tissues and we found a strong correlation between the
expression of 3′end processing machinery genes and shorter 3′UTR
length, consistent with the previous studies^[215]18. We, therefore,
reasoned that the differences in APA between EAs and AAs could be due
to global patterns of 3′end machinery expression or focal regulation by
specific APA factors. In breast cancer, the occurrence of shorter 3′UTR
transcripts was indeed significantly linked with a higher PA machinery
score. Interestingly, Tang and colleagues recently demonstrated a
higher concordance between mRNA and protein in breast tumors from AAs
compared with EAs. Our findings in breast cancer are consistent with
these findings, where in general, AAs had a longer 3′UTR compared with
EAs, implicating tighter control and regulation of mRNA
translation^[216]47.
A key strength of this study is our use of a specific method to
sequence and map polyA sites, rather than traditional 5′–3′ sequencing
methods. This method circumvents the issue of saturation encountered by
previous 5′–3′ RNA-seq methods and enables a comprehensive
identification of APA events, including, for example, our
identification of non-coding RNA isoforms and recurrent APA in lung
cancer. Previous APA studies of cancer have used EST databases^[217]59
and microarrays^[218]11,[219]18, which, though not incorrect, are
limited by dependence on the annotation of APA sites by EST databases,
the proportion of genes covered by the probes, probe design, and
technical difficulties when a gene has more than two polyA
sites^[220]10. Methods based on traditional RNA-seq also have
limitations. For example, while it is possible to detect polyA sites
through the detection of sequences with stretches of As, only a small
proportion of RNA-seq reads contain polyA tails, limiting the ability
to identify APA events^[221]26,[222]27. Of note, an ultra-deep
sequencing study identified only ~40,000 putative polyA reads (~0.003%)
from 1.2 billion total RNA-seq reads^[223]25. Also, short 3′UTRs are
often embedded within long ones, and thus isoforms with short 3′UTRs
are commonly overlooked by transcript assembly tools, though methods
have been developed to overcome these limitations^[224]24. Thus, by
leveraging 3′end-enriched RNA-seq methods, we have been able to
comprehensively map the APA landscape in lung cancer.
Another strength of our study is the use of predominantly matched tumor
and adjacent non-involved tissues and ERCC spike-in RNAs as controls
for the sequencing method. It is possible that our study has missed
some polyA sites—approximately 20% of human polyA sites do not contain
a canonical hexamer (or one of its variants), instead relying on
binding to the UGUA or downstream sequences^[225]60. Also, our analysis
filtered out polyA sites without a well-characterized hexamer in the
upstream pipeline making it possible that we overlooked a small portion
of regulated APA events. A limitation of our work regarding population
differences in APA that should be considered is our use of
self-reported race in the classification of EAs and AAs. The race is a
socially constructed variable that categorizes people based on
non-biological characteristics.
Some, not all, members of the same race may also share common biology.
We have previously shown that African American lung cancer patients
have greater enrichment of genomic, transcriptomic, and proteomic
profiles^[226]28,[227]61. However, these biological determinants cannot
account for all the differences observed. While we cannot pinpoint
social, environmental, or genetic factors that would impact population
differences in APA, in line with recent recommendations we have tried
explaining how our populations were selected^[228]62.
In summary, our study describes a level of transcriptomic regulation by
APA that is associated with patient survival in lung cancer and yields
insight into tumor biology and transcriptional heterogeneity that are
missed by general transcriptome analyses. We find gene-level population
differences in APA in lung cancer, and both gene-level and global
differences in 3′UTR length in breast cancer. Finally, our description
of recurrent and clinically relevant APA events in non-coding RNAs in
lung cancer identifies a form of non-coding RNA expression control
whereby APA acts as a dynamic docking location for RNA binding
proteins.
Methods
Study subjects
Ninety-eight patients with histologically confirmed non-small cell lung
cancer were selected from the National Cancer Institute-Maryland
(NCI-MD) lung cancer study. This NCI-MD Case Control Study was
conducted in accordance with the Declaration of Helsinki. Institutional
review board approval was granted from NCI and participating hospitals
and registered on clinicaltrials.gov
[[229]https://clinicaltrials.gov/ct2/show/NCT00339859]. The cohort
included 46 AAs and 52 EAs (Table [230]1). The population accrual and
eligibility criteria for this study were previously
described^[231]63,[232]64. Written informed consent was obtained from
each participant.
Table 1.
Demographic characteristics of the population.
African American European American p-value
Age 63.7 (8.4) 65.2 (9.3) 0.16
Sex
Male 10 (21.7) 17 (32.7) 0.28
Female 36 (78.3) 35 (67.3)
Smoking status
Never 3 (6.5) 3 (5.8)
Former 15 (32.6) 19 (36.5) 0.78
Current 25 (54.3) 29 (55.8)
Missing 3 (6.5) 1 (1.9)
Histology
Adenocarcinoma 25 (54.3) 21 (37.5)
Squamous 14 (30.4) 21 (37.5) 0.57
Other 7 (15.2) 10 (19.2)
Stage
I 23 (50.0) 35 (67.3)
II 14 (30.4) 12 (23.1) 0.27
III 7 (15.2) 3 (5.8)
Missing 2 (4.4) 2 (3.9)
[233]Open in a new tab
Individuals in this study self-reported as either African American or
European American. Our previous work with this population indicates
that the median West African ancestry in self-reported African
Americans is 77%^[234]61,[235]65. Eligible participants took part in a
structured in-person interview from which demographic and lifestyle
factors were documented. Clinical data were obtained from medical
records and pathology reports for each patient. Fresh human lung tumor
and matched adjacent non-involved lung tissues were obtained from
patients directly after surgery. Each tissue was transferred to a
sample collection tube, flash frozen, and stored at −80 °C until
molecular analyses were performed. The study included 98 tumor tissues
and 98 adjacent non-involved tissues (n = 196 total).
RNA library preparation and sequencing
Construction of RNA libraries was performed using the QuantSeq Rev
3′mRNA-Seq Library Prep Kit for Illumina (Lexogen, Vienna, Austria)
according to the manufacturer’s instructions. Briefly, 500 ng of total
RNA was reverse transcribed with an oligo(dT) primer containing an
Illumina-specific linker sequence, followed by removal of RNA and
second-strand cDNA synthesis with random primers. The resulting
double-stranded cDNA was purified with magnetic beads. Libraries were
amplified by PCR with primers containing Illumina adaptors and
sample-specific barcodes and then purified with magnetic beads. The
High Sensitivity DNA analysis Kit (Agilent, Santa Clara, CA) was used
for library quantification.
Libraries were pooled and sequenced on the Illumina Hiseq 2500 with
100 bp single-end reads. Eight samples were run per lane, including 4
tumors and 4 adjacent non-involved samples derived from 2 AA and 2 EA
to limit bias. The QuantSeq Rev kit includes a customized sequencing
primer that anneals to the linker sequence previously introduced in the
oligo(dT) priming step. Reads are strand-specific and generated from
the 3′untranslated region and last exon in a 3′–5′ direction. The
method generates one fragment per transcript, which also facilitates
gene expression analyses. In total, we sequenced 196 samples, which
produced, on average, 20.6 million reads per sample.
Generation of the global polyadenylation atlas
Data analysis was performed with expressRNA^[236]66 (expressRNA.org;
[237]https://github.com/grexor/apa), an open-source modular and
scalable platform that provides a complete analytical framework
incorporating tools for read alignment, genome annotation, and calling
of differentially polyadenylated genes.
The 3′UTR sequence data were processed and mapped to the genome using
STAR, which allows soft clipping from both 5′ and 3′ ends. On average,
74% of the reads from each sample aligned to the hg38 reference genome.
We then considered the locus of the last nucleotide of each alignment
at the 3′ end and clustered the signal across all samples to obtain a
global polyadenylation atlas. Since oligo-dT priming is known to cause
internal-priming events, we only considered loci that had any of the 18
characterized PAS in the [−30….−10] nt region relative to the detected
cleavage site^[238]30. We additionally filtered out genomic positions
that had more than 6 consecutive As or more than 8 sparse As in any 10
nt window in the regions spanning the detected cleavage site ([−10….10]
nt) to filter out internal-priming events.
Since cleavage is not a nucleotide exact process and tends to occur
within a small window of positions around the dominant cleavage site,
we summed the read counts from cleavage sites up to 5 nt away from each
dominant polyA site^[239]66. We also selected a representative cleavage
site for each of the PAS signals. To focus on fully independent
cleavage sites with their own PAS and cis-regulatory elements, we
identified the dominant polyA sites based on read count and ranked them
in descending order, such that all resulting sites were at least 125 nt
apart^[240]66. Since 3′UTR isoforms are not always fully annotated, we
added 5 kb of the intergenic region downstream of each gene. If two
genes were closer than 10 kb, only the region up to the middle of the
beginning of the downstream gene was added. To avoid spurious cleavage
and polyadenylation events, we only kept polyA sites that were present
across at least 25% of samples^[241]66. To avoid poorly used sites,
polyA sites with less than ten read counts in either adjacent
non-involved or tumor tissues were filtered out. We then discarded
those polyA sites that had less than 5% of reads compared with the
major polyA site in the same gene^[242]66.
We further classified regulated polyA sites based on their position in
the gene; (a) same-exon pairs—if both proximal and distal sites are
located in the same exon, (b) composite-exon—if the proximal site is
part of a composite-exon, i.e., containing an internal 5′ splice and
the two sites were generated by alternative use of that splice site,
and (c) skipped-exon sites—if the proximal site is part of an exon that
is fully spliced^[243]66.
Correlation between non-coding RNA expression and APA
We first performed quality and adapter trimming by using the cutadapt
tool to remove the NEB 5′ (GTTCAGAGTTCTACAGTCCGACGATC) and 3′
(AGATCGGAAGAGCACACGTCT) adapters. For isomiRs, we mapped reads to
precursors from miRbase version 22 using exhaustive string comparisons
while disallowing mismatches, insertions, or deletions. IsomiRs were
then annotated to include offset positions^[244]67 to indicate how
their 5′ and 3′ ends differ from that of the annotated reference
mature.
We used available microRNA binding site annotation from APADB to enrich
the polyA sites. Bedtools set operation were used to assess the lost
microRNA binding sites. Correlation was carried out by using the log2
tumor and normal PSI ratio and gene transcripts per million (TPM) from
RSEM for 60 LincRNA matched genes. For LincRNA isoforms, the
identification and quantification of APA events between tumor and
matched normal tissues was performed by using delta Percentage of
Distal polyA site Usage Index (dPDUI or ΔPDUI) from DaPARS^[245]24 with
all default parameters. The same trend was defined as that shorten 3′
APA corresponds with lower gene expression and genes on opposite trend
as that shorten 3′ APA corresponds with higher gene expression in tumor
and normal samples.
Derivation of PSI from TCGA samples
The ΔPDUI measure derived from DaPARS^[246]24 were mined from The
Cancer 3′ UTR Atlas (TC3A), a comprehensive resource of APA usage for
10,537 tumors across 32 cancer types [247]http://tc3a.org and converted
to PSI (1- PDUI). Codes generated to analyze this data set are provided
at [248]https://github.com/ruppinlab/apa_lung.git. Race information is
self-reported.
CTPAC analysis: We downloaded the protein abundance information for
primary breast cancer samples of the TCGA cohort from CTPAC portal
[[249]https://cptac-data-portal.georgetown.edu/datasets] and downloaded
their respective mRNA expression profile from GDAC
[[250]https://portal.gdc.cancer.gov/] firehose portal. We next ranked
each gene by its median PSI index higher to lower and asked whether the
top 10% genes going (high 3′ shortening in tumors) have a stronger
correlation between their mRNA and protein across patients than the
bottom 10% of the genes (high 3′ elongation in tumors). We repeated
this analysis for lung tumors samples by mining the mRNA-protein
correlation information from Gillette et al.^[251]41. Codes used to
analyze this data set are provided at
[252]https://github.com/ruppinlab/apa_lung.git. Race information is
self-reported.
Analysis of RIP-seq data
We downloaded the RNA immunoprecipitation (RIP-seq) assays profile
measuring ELAV1 DNA binding of transformed K562 leukemia cells and
normal Gm12878 cells as a control from [253]GSE35585 For a given gene
or element (miRNA or long non-coding RNA), ELAV1 binding is quantified
by counting the number of reads between primary proximal and distal
polyA site of usage in both cell lines individually. Codes used to
analyze this data set are provided at
[254]https://github.com/ruppinlab/apa_lung.git. Race information for
this data set is self-reported.
Calculation of Polyadenylation Machinery Index
We mined the expression levels of 19,001 genes in 8749 tumor samples
from TCGA cohort^[255]68. For a subset of core regulatory genes of
polyadenylation of mRNA pathway (biocarta_cpsf_pathway, [256]M22041,
[[257]https://data.broadinstitute.org/gsea-msigdb/msigdb/biocarta/human
/h_cpsfPathway.gif]), we identified their median z-score expression for
each sample and defined it as PA machinery activity index. Codes used
to analyze this data set are provided at
[258]https://github.com/ruppinlab/apa_lung.git. Race is self-reported
for this data set.
Identification of clinically relevant APA events
To determine whether APA captures genes with clinical relevance, we
first performed a lasso regression (feature selection step) for each
gene, which yielded 21 genes whose PSI values are associated
independently with survival. Using the PSI levels of these 21 genes and
their corresponding hazard ratio from multivariate regression
correcting for patient age, sex, race, and tumor stage as their linear
weights, we generated a prognostic index for each sample in
leave-one-out cross-validation. Thus, the Prognosis Index (PI) of kth
sample is defined as,
[MATH: PI=∑i=1mβiχi :MATH]
where, β is the cox-risk coefficient of gene i,
[MATH: χ :MATH]
is the gene i PSI value. The patients with a PI greater than the median
are categorized as low-risk and the rest as high-risk (Fig. [259]2f).
Reporting summary
Further information on research design is available in the [260]Nature
Research Reporting Summary linked to this article.
Supplementary information
[261]Supplementary Information^ (4.9MB, pdf)
[262]Peer Review File^ (1.3MB, pdf)
[263]41467_2021_25763_MOESM3_ESM.pdf^ (87.9KB, pdf)
Description of Additional Supplementary Files
[264]Supplementary Data 1-20^ (20.4MB, zip)
[265]Supplementary Software 1^ (344.9KB, pdf)
[266]Reporting Summary^ (243.3KB, pdf)
Acknowledgements