Abstract

   Long non-coding RNAs (lncRNAs) have emerged during the post-genomic era
   as significant epigenetic regulators. Viral-like 30 elements (VL30s)
   are a family of mouse retrotransposons that are transcribed into
   functional lncRNAs. Recent data suggest that VL30 RNAs are efficiently
   packaged in small extracellular vesicles (SEVs) through an SEV
   enrichment sequence. We analysed VL30 elements for the presence of the
   distinct 26 nt SEV enrichment motif and found that SEV enrichment is an
   inherent hallmark of the VL30 family, contained in 36 full-length
   elements, with a widespread chromosomal distribution. Among them, 25
   elements represent active, present-day integrations and contain an
   abundance of regulatory sequences. Phylogenetic analysis revealed a
   recent spread of SEV-VL30s from 4.4 million years ago till today.
   Importantly, 39 elements contain an SFPQ-binding motif, associated with
   the transcriptional induction of oncogenes. Most SEV-VL30s reside in
   transcriptionally active regions, as characterised by their
   distribution adjacent to candidate cis-regulatory elements (cCREs).
   Network analysis of SEV-VL30-associated genes suggests a distinct
   transcriptional footprint associated with embryonal abnormalities and
   neoplasia. Given the established role of VL30s in oncogenesis, we
   conclude that their potential to spread through SEVs represents a novel
   mechanism for non-coding RNA biology with numerous implications for
   cellular homeostasis and disease.

   Keywords: small extracellular vesicles, VL30 lncRNA, non-coding RNAs,
   cancer, SFPQ

1. Introduction

   Based on the latest Gencode reference annotation, the mouse genome
   contains >13,000 long non-coding RNAs (lncRNAs) [[26]1]. Non-coding
   RNAs’ annotation and functional characterisation are critical to
   understand their contribution to physiological and pathological
   processes. Among the most acknowledged functions of lncRNAs is their
   role in epigenetic gene regulation through several mechanisms, such as
   of histone modifications, transcription factor recruitment, mRNA
   stability and miRNA occupancy [[27]2]. Given the diverse biological
   roles of lncRNAs, they participate in several pathophysiological
   processes [[28]3]. Among the most studied examples are those of ANRIL
   (Antisense Non-coding RNA in the INK4 Locus), HOTTIP (HOXA transcript
   at the distal tip) and XIST (X-inactive specific transcript) lncRNAs
   [[29]4,[30]5,[31]6]. lncRNA ANRIL recruits the polycomb repressive
   complex in cell cycle regulatory genes, an action that is associated
   with cancer induction. HOTTIP, another oncogenic lncRNA, activates HOXA
   genes and is involved in leukemogenesis. XIST lncRNA has multiple roles
   in developmental X-chromosome inactivation and is also implicated in
   cancer induction. Recent studies have systematically verified the
   impactful physiological and pathological roles of lncRNAs as part of
   gene regulatory networks that also include microRNAs
   [[32]7,[33]8,[34]9].

   One of the known functional lncRNAs in the mouse genome is the RNA
   transcript from viral-like 30 elements (VL30s) that was characterised
   as early as 40 years ago [[35]10]. VL30 RNA is a lncRNA with the
   capacity of packaging in type-C retroviral particles and is competent
   for reverse transcription and retrotransposition [[36]11]. Our research
   team has previously calculated that VL30s appeared in the mouse
   germline 17.2 million years ago and have since spread through
   consecutive retrotransposition events [[37]11]. Today, the reference
   mouse genome contains 372 VL30 sequences, categorised as 86 full-length
   and 49 truncated copies as well as 237 solo LTRs (long terminal
   repeats) with discrete chromosomal distribution [[38]11]. VL30s contain
   in their LTRs a plethora of regulatory sequences, allowing their
   regulation by several stimuli, such as oncogenic and oxidative stress,
   classifying VL30s to be transcriptionally regulated as early response
   genes [[39]12,[40]13,[41]14,[42]15,[43]16,[44]17].

   VL30 lncRNAs may affect cellular physiology by at least two distinct
   mechanisms. First, the vast majority of VL30 RNAs contain sequences
   that render them retrotransposition-competent [[45]18]. VL30
   retrotransposition is a highly mutagenic phenomenon that is associated
   with genetic plasticity and epigenetic deregulation that may lead to
   epithelial-to-mesenchymal transition and cancer stem cell formation
   [[46]19]. An additional property of VL30 RNA is the direct binding to
   SFPQ (Splicing Factor Proline And Glutamine Rich), with a physiological
   role in steroidogenesis [[47]20]. However, abnormal up-regulation of
   VL30 RNA may lead to carcinogenesis by SFPQ-dependent oncogene
   activation [[48]21]. Based on recent results, we have proved that SFPQ
   binding is a universal feature of the VL30 family, with 83/86 of
   full-length elements containing at least one SFPQ-binding motif
   [[49]11]. In summary, VL30 lncRNA is implicated in (patho)physiology
   with at least two mechanisms, competence for retrotransposition and
   SFPQ binding, acting as both genetic and epigenetic regulators in
   homeostasis and disease.

   Small extracellular vesicles (SEVs) are created by cells as a delivery
   mechanism of proteins, lipids or nucleic acids and as a medium of
   extracellular communication. Upon their discovery, SEVs were considered
   as a waste disposal mechanism. Today, SEVs have emerged as major
   players in several cellular processes, including immunoregulation, CNS
   development and homeostasis, tissue regeneration, inflammation and
   coagulation [[50]22]. A recent report by Barrios et al. [[51]23]
   quantified the RNA expression in SEVs derived from mouse dendritic
   cells. The most enriched RNAs (>200-fold abundance compared to cellular
   RNAs) were found to be VL30 lncRNAs. The authors have systematically
   analysed exosome-containing VL30 RNAs to find a distinct 26-nucleotide
   motif that is associated with SEV loading and an interferon type I
   response. Among the main conclusions from this seminal study was that
   the enrichment of VL30s RNAs into SEVs in conjunction with an
   immunostimulatory effect leads to their removal from the cell. This
   mechanism may act in general as a cellular “garbage-bin” to avoid
   potential toxic effects from non-coding RNAs and avoid
   autoinflammation.

   The aim of the current report was to find the origins and functions of
   VL30s that are packaged in SEVs and to establish whether they are a
   distinct group within the VL30 family. Towards this aim, we performed
   the analysis of phylogenetic and genomic distribution and enriched gene
   pathways and networks data. Our results support that the SEV enrichment
   motif occurred 4.4 million years ago (MYA) and spread through
   retrotransposition to at least 40 elements. Network analysis suggest a
   stress-associated transcriptional footprint. We conclude that
   enrichment into SEVs leads to the horizontal transfer of oncogenic VL30
   lncRNAs with apparent implications in cellular pathophysiology.

2. Materials and Methods

2.1. Sequence Analysis

   Blast Like Alignment tool (BLAT) web interface in the UCSC Genome
   Browser ([52]http://genome.ucsc.edu/ accessed on 14 September 2021) was
   used for finding SEV enrichment motifs in the latest assembly (mm39) of
   the mouse genome [[53]24,[54]25,[55]26]. Genomic coordinates of
   SEV-VL30s were obtained using UCSC Table browser [[56]27]. Basic Local
   Alignment Search tool (BLAST) [[57]28] implementation in NCBI website
   ([58]https://blast.ncbi.nlm.nih.gov/Blast.cgi accessed on 14 September
   2021) was used to query for the presence of SEV enrichment motifs in
   the genomes of the Mus genus. The chromosomal distribution of SEV-VL30s
   was depicted in the Ensembl Genome Browser ([59]https://ensembl.org/
   accessed on 14 September 2021) [[60]29,[61]30]. The presence of
   candidate cis-regulatory elements by ENCODE [[62]31] was performed in
   UCSC Table browser. Genomic Regions Enrichment of Annotations Tool
   (GREAT) [[63]32] web implementation
   ([64]https://great.stanford.edu/great/ accessed on 5 October 2021) was
   used to annotate SEV-VL30s in relation to transcription start sites
   (TSSs) of mouse genes. GREAT associates genomic regions with their
   nearby genes and applies the gene annotations to the regions, based on
   binomial and hypergeometric statistical tests, over regions and genes,
   respectively. Association is two-step. Every gene is assigned a
   regulatory domain, and then, each region is tested whether it overlaps
   with gene regulatory domains.

2.2. Molecular Phylogenetic Analysis

   Multiple sequence alignment was conducted using the MUSCLE algorithm
   [[65]33], as implemented in the European Bioinformatic Institute
   website ([66]https://www.ebi.ac.uk/Tools/msa/muscle/ accessed on 5
   October 2021). The phylogenetic tree was constructed following
   evolutionary history inference using the Neighbour-Joining method
   [[67]34]. The evolutionary distances were computed using the Maximum
   Composite Likelihood method [[68]35] and are in the units of the number
   of base substitutions per site. This analysis involved 40 nucleotide
   sequences. There were a total of 1130 positions in the final dataset.
   Evolutionary analyses were conducted in MEGA11 [[69]36]. The
   phylogenetic tree of the Mus genus was generated using TimeTree
   [[70]37] web interface ([71]http://www.timetree.org/ accessed on 5
   October 2021).

2.3. Pathway and Network Analysis

   Network analysis was performed in Genemania, a binary classification
   algorithm for network construction [[72]38,[73]39], in the web server
   ([74]https://genemania.org/ accessed on 6 October 2021), using Gene
   Ontology-based weighting methods. Enriched pathway analysis was
   performed in Enrichr [[75]40,[76]41]
   ([77]https://maayanlab.cloud/Enrichr/ accessed on 6 October 2021),
   using default settings. Briefly, the gene set of interest was compared
   with preset gene set libraries in the Enrichr server, for significant
   correlations (p < 0.05) based on the Fisher exact test. The results
   were viewed using Appyters [[78]42].

3. Results

3.1. SEV Enrichment Motif Is a Universal Feature of VL30 Family

   The efficient packaging of VL30 lncRNAs in small extracellular vesicles
   (SEVs) is associated with the presence of a 26-nt-long preserved SEV
   enrichment motif [[79]23]. We analysed VL30 elements for the presence
   of a 26-nt SEV motif consensus sequence (AGATCGTGGGTTCGAGTCCCACCTCG).
   We found that the SEV motif is contained in 34 full-length and four
   truncated elements, with a widespread chromosomal distribution
   ([80]Figure 1 and [81]Supplementary Table S1). Elements with SEV
   motif(s) are characterised as SEV-VL30s thereafter. Previously, we have
   systematically annotated VL30s and have calculated the integration time
   for individual elements [[82]11], since the current integrations have
   the highest probability to be transcriptionally active and
   retrotransposition-competent. Importantly, most SEV-VL30s, 25/36
   full-length elements, are current integrations with intact and
   identical LTRs (depicted with red arrows in [83]Figure 1).

Figure 1.

   [84]Figure 1
   [85]Open in a new tab

   Genomic distribution and features of SEV-VL30s. Arrows on the left or
   right side of chromosomes indicate full-length or truncated VL30
   elements, respectively. Active elements (contemporary integrations), as
   described in [[86]11], are indicated by red arrows.

3.2. Structural and Functional Properties of SEV-VL30 RNAs

   In a later step, we systematically annotated the structural properties
   of SEV-VL30s. As found in the previous section, 25/36 full-length
   elements contain identical 5′ and 3′ LTRs, consensus sequences that are
   prerequisites for retrotransposition. LTRs, primer binding sites (PBS)
   and the polypurine tract (PPT) are the required sequence hallmarks for
   retrotransposition competence. Importantly, we found that all
   full-length elements contain both PBS and PPT sequences ([87]Figure 2
   and [88]Supplementary Table S1). A total of 35/36 elements contain a
   PBS sequence that is complementary to Gly tRNAs and one element to Met
   tRNA. PPT is highly conserved and no mutations from the consensus
   sequence were detected in SEV-VL30s. A characteristic sequence of 4 bp
   target genomic site duplication (TSD) following retrotransposition is
   detected in each case, revealing recent retrotranspostition activity.
   The collective results show that SEV-VL30 elements contain intact
   sequences that enable reverse transcription and integration; namely, 5′
   and 3′ LTRs, PBS and PPT.

Figure 2.

   [89]Figure 2
   [90]Open in a new tab

   Structural properties of full-length SEV-VL30s. From left to right:
   TSD: Target site duplications, hallmark of integrations following Long
   Terminal Repeat (LTR) retrotransposition; U3-R-U5: structure of
   full-length LTRs (size of each LTR in base-pairs (bp) is depicted in 3′
   LTR); PBS: Primer binding site, necessary for minus strand
   amplification during reverse transcription, including consensus
   sequences for the two types of tRNA species that are complementary for
   PBS; SFPQ-BM: Binding motifs for SFPQ protein; Gag and pol retroviral
   genes (* consensus sequences contain multiple stop codons and render
   VL30s non-autonomous retrotransposons); PPT: polypurine tract,
   necessary for puls strand amplification during reverse transcription.

   SFPQ binding of VL30 RNA is mediated by two distinct sequence motifs
   that are hallmarks of VL30 family members [[91]11]. Importantly, we
   found that the vast majority of full-length SEV-VL30s (35/36) contain
   at least one SFPQ binding motif ([92]Figure 2 and [93]Supplementary
   Table S1).

   The results of structural and functional analysis reveal that: (1)
   SEV-VL30s are potent for retrotransposition, since they contain the
   hallmark sequences of LTR, PBS and PPT, and (2) SFPQ binding, since
   they contain at least one SFPQ binding motif. Collectively, the
   horizontal transfer of SEV-VL30s on target cells may lead to genetic
   and/or epigenetic disequilibrium that is associated with oncogenesis.

3.3. Insights into the Evolution of SEV-VL30s

   In order to identify the evolutionary history of SEV binding in VL30s
   within the mouse germline, we performed phylogenetic analysis for
   SEV-VL30s. Using the MUSCLE algorithm, 5′ LTRs of SEV-VL30s were
   aligned, and a phylogenetic tree was drawn using the Neighbour-Joining
   method ([94]Figure 3). The time of integration, as has been calculated
   in a previous study from our group [[95]11], is shown beside the name
   of each SEV-VL30 (excluding contemporary elements that are calculated
   as today’s integrations). The final evolutionary tree includes the
   combined information of VL30 integration time and the divergence of
   individual SEV-VL30s. The SEV motif seems to have occurred ~4.4 million
   years ago (MYA), and 13 qB1 VL30 is the first known to have acquired
   this sequence and can be characterised as the founding SEV-VL30
   element. The tree depicts a first wave of expansion including 13 qB1,
   indicated in the lowest node of the tree, and at least four additional
   contemporary expansions/integrations of SEV-VL30s that lead to the
   spread of this feature that we observe today in the mouse genome.

Figure 3.

   [96]Figure 3
   [97]Open in a new tab

   Evolutionary relationships of SEV-VL30s. The evolutionary history was
   inferred using the Neighbour-Joining method. The optimal tree is shown.
   The evolutionary distances were computed using the Maximum Composite
   Likelihood method and are in the units of the number of base
   substitutions per site. This analysis involved 40 nucleotide sequences.
   All ambiguous positions were removed for each sequence pair (pairwise
   deletion option). There were a total of 1130 positions in the final
   dataset. Numbers in parentheses denote integration time, while asterisk
   denotes truncated elements in which integration time cannot be
   calculated.

   The Mus genus contains a number of highly similar species that diverged
   from a common ancestor about 10 MYA. To gain further insights into the
   origins of SEV enrichment features, we explored the existence of the
   SEV motif in the 30 known species that belong to the Mus genus and
   found that the conserved 26-nt consensus SEV motif is present only in
   the genomes of Mus musculus and Mus spretus ([98]Figure S1).
   Importantly, the divergence time between Mus musculus and Mus spretus
   is ~3 MYA, which is in accordance with the result from our previous
   analysis that indicates an occurrence time of ~4.4 MYA. Collectively,
   our data indicate that SEV motifs occurred in the Mus germline ~4.4 MYA
   and have since expanded only in Mus musculus through SEV-VL30
   retrotransposition.

3.4. Epigenetic Regulation of SEV-VL30s

   In the next step, we analysed the transcriptional potential of
   SEV-VL30s. The database of candidate cis-regulatory elements (cCREs)
   integrates high-throughput epigenetic data on DNAseI digestion sites,
   the histone modifications of H3K4me3 and H3K27ac and CTCF ChIP-seq data
   produced by the ENCODE and Roadmap Epigenomics Consortia. The existence
   of cCREs is considered a strong indication for transcriptional activity
   [[99]31]. We screened the annotated SEV-VL30s for the existence of
   cCREs and found that 25/40 elements reside adjacent to cCREs and
   evaluated their function ([100]Table 1). The cCRE elements related to
   SEV-VL30s include 11 promoters, 39 proximal enhancers, 88 distal
   enhancers, 3 DNAse I/H3 K4me3 regions and 7 CTCF binding sites.

Table 1.

   CRE-VL30s adjacent to cCREs.
   CRE-VL30 Nearest Genes (Distance to TSS) cCRE Type/Function
   1qA5 Lmbrd1 (+338,654), Adgrb3 (+812,423) enhD (2X)
   1qD Alppl2 (+11,819), Dis3l2 (+374,273) enhD, CTCF
   2qC3tr Hnrnpa3 (−18,737), Mtx2 (+814,721) enhP (4X), enhD (5X)
   4qA1 Car8 (−156,331), Rab2a (−140,272) enhD
   4qB3tr Rad23b (+70,666), Klf4 (+111,757) CTCF
   4qE1-2 Zfp989 (−32,805), Gm21,411 (−29,581) K4m3, enhP
   4qE2 Ube4b (−9840), Rbp7 (+18,389) Prom, enhP (5X), enhD (6X)
   5qG2 Ccl24 (−53,256), Rhbdd2 (−6313) Prom, enhP (2X), CTCF (2X), K4m3
   6qG2 Gm6614 (−158,676), Slco1a6 (+16,063) enhP, enhD
   8qA4 Gtf2e2 (−16,097), Gsr (+63,004) enhD (3X)
   8qC3 Zfp791 (−16,620), Cks1brt (−12,209) enhD (2X)
   8qD3 Tango6 (−4073) prom, EnhP, enhD (2X), CTCF (2X)
   11qA1 Alas2 (−59,876), Tmem29 (−28,349) enhP (4X), enhD (3X)
   11qC Ankrd36 (−14,253), Ccdc117 (−13,244) prom, enhP (2), enhD (4X)
   12qC1 Dhx40 (−6323), Ypel2 (+179,638) Prom, enhP (5X), enhD (2X)
   13qA1 Fbxo33 (−5156) enhD (6X)
   13qA3-1 Tbce (+16,998), B3galnt2 (+68,171) prom (3X), enhP (2X), enhD
   (2X)
   13qA5 Hist1h2bn (+11,370), Hist1h1b (+15,132) prom, enhP (5X), enhD,
   K4m3
   13qB1 Shc3 (−69,417), Cks2 (−8731) enhD (7X), CTCF
   13qB3tr Nsd1 (−22,938), Fgfr4 (+34,204) enhD (3X)
   14qB Cts3 (−517,722), Zfp808 (−42,067) enhD (7X)
   15qE1 Dph3 (−32,316), Msmb (−24,101) prom (2X), enhP (4X), enhD (7X)
   18qE4 Ndufa6 (−10,978), Cyp2d22 (+14,991) enhD (3X)
   19qA2 Tmx3 (−672,104), Dok6 (−68,522) prom (2X), enhP (3X), enhD (16X)
   XqF3 Gstp3 (−4429) enhD (3X)
   [101]Open in a new tab

   * cCRE type: Prom: Promoter; enhP: proximal enhancer; enhD: distal
   enhancer; CTCF: CTCF binding site; K4m3: DNAse I/H3 K4me3 region.

   Using the GREAT tool, which uses a combined statistical analysis to
   associated gene regulatory domains with genomic regions, we calculated
   the distance between cCRE-related SEV-VL30s and transcription start
   sites (TSSs) of the nearest mouse genes. The 25 elements reside in the
   vicinity of TSSs from 47 mouse genes, in distances as near as 4429 bp
   ([102]Figure S2). To further evaluate the regulatory impact of
   potentially active CRE-VL30s, we generated a regulatory network
   containing the 47 CRE-VL30-related genes ([103]Figure 4). Importantly,
   the majority of the genes in the inferred network physically interact
   and a percentage of them are associated with ubiquitin–protein binding
   (Rab23a, Rab23b, Csk1b, Csk2) as well as cyclin-dependent protein
   phosphorylation (Csk1b, Csk2, Csk1brt). GREAT analysis of
   non-SEV-associated VL30s revealed a different dataset of 510 genes.
   Only Gtf2e2 and Gsr were common among the two gene sets ([104]Figure
   S3).

Figure 4.

   [105]Figure 4
   [106]Open in a new tab

   Network analysis of CRE-VL30-related genes. The final network includes
   47 input genes (indicated with stripes) and 20 related genes. In total,
   67 genes and 353 total links are presented. Interactions in the network
   are depicted in different line colours while functions are depicted in
   coloured circles representing individual proteins (see legend above for
   details).

   To further evaluate possible shared functions of SEV-VL30 genes, we
   performed enrichment analysis in Enrichr. Based on data from MGI
   Mammalian Phenotype Level 4 2021, we found that our dataset is
   enriched, among others, in the following datasets ([107]Figure S4):
   embryonic lethality prior to organogenesis (MP:0013292), abnormal
   embryo size (MP:0001697), increased cardiac cell glucose uptake
   (MP:0030018), increased prostate intraepithelial neoplasia incidence
   (MP:0009219), abnormal gastrulation movements (MP:0002174) and
   preweaning lethality (MP:0011100). Next, we analysed the enriched
   pathways for the dataset of 510 non-SEV VL30 genes ([108]Figure S5).
   The enriched pathways of SEV-VL30 genes were found to be distinct to
   those associated with non-SEV VL30s.

   Collectively, most SEV-VL30s reside in transcriptionally active
   regions, as characterised by cCREs. Nearby genes are transcribed into
   proteins that physically interact and their expression is associated
   with embryonic abnormalities and neoplasia. The genomic distribution of
   SEV-VL30s is distinct to the remaining non-SEV elements. We conclude
   that SEV-VL30s are related to specific cellular functions, distinct
   from non-SEV VL30s.

4. Discussion

   In this study, we established the origins of VL30s that are packaged in
   SEVs and proved that they formed a distinct functional group of 40
   elements within the VL30 family. SEV enrichment evolved ~4.4 MYA and
   expanded as an inherent hallmark of the VL30 family along with recent
   VL30 expansions through retrotransposition. Most current SEV-VL30
   integrations contain hallmarks of active transcription,
   retrotransposition competency and are associated with developmental
   abnormalities and neoplasia. In conclusion, the potential of VL30
   lncRNAs through SEVs suggests a significant pathophysiological role in
   target cells.

   The SEV-VL30 lncRNAs are associated with cancer with at least two
   mechanisms. First, high-frequency retrotransposition as a result of
   stress is associated with epithelial-to-mesenchymal transition and
   cancer stem cell formation [[109]19]. Second, SFPQ binding is
   associated with oncogene transcription and cancer induction [[110]43].
   In our study, we confirm that all SEV-VL30s contain the sequence
   hallmarks for retrotransposition induction, while 35 SEV-VL30s also
   contain SFPQ binding motifs. Thus, SEV-VL30s can be transcribed as
   oncogenic lncRNAs that also encode the potential to spread through SEV
   formation. The horizontal transfer of VL30 RNAs on target cells that
   may endocytose such SEVs may lead to oncogenesis through
   retrotransposition and/or SFPQ binding. Baris et al. suggest that SEV
   formation is an effective mechanism for the clearance of potentially
   toxic RNAs [[111]23]. We cordially agree with this notion. The potent
   interferon I response against VL30-SEVs is also consistent with an
   antiviral immune stimulation, which may pose a defensive mechanism
   against the horizontal transfer of oncogenic VL30 RNAs through SEVs.
   Further studies would warrant the impact of the interplay between SEVs
   containing VL30 RNAs and host cell mechanisms.

   VL30 elements appeared in the Mus germline ~17 MYA and the largest wave
   of expansion is calculated at <1 MYA, resulting in 86 full-length
   elements in today’s mouse genome [[112]11]. We suggest that the SEV
   motif was “embedded” in a VL30 integration, most probably 13qB1, before
   the main wave of VL30 expansions through retrotransposition, which
   ultimately led to the establishment of SEV enrichment as a hallmark of
   the VL30 family. In a previous report, we have demonstrated that SFPQ
   binding is a universal feature of VL30 elements and has spread in
   parallel to the VL30 expansions >17 million years ago [[113]11].
   Therefore, most VL30s contain SFPQ binding sites, while less contain an
   SEV enrichment motif, calculated in the current report to have occurred
   4.5 MYA. Ultimately, both structural features have been expanded
   through retrotransposition events, connecting epigenetic regulation
   through SFPQ binding to horizontal gene transfer through extracellular
   vesicles.

   The transcriptional profile of individual VL30s is known to be
   cell-type-specific [[114]44] and inducible upon several types of
   stress, including oncogenic and oxidative stress as well as hormonal
   stimulation [[115]16,[116]17,[117]18]. In the current study, we
   assessed the transcription competency of SEV-VL30s and found that the
   majority are associated with candidate cis-regulatory elements (cCREs)
   by ENCODE [[118]31]. Twenty-five SEV-VL30s adjacent to cCREs reside in
   the vicinity of 47 mouse genes. Importantly, most of the SEV-VL30s
   reside less than 50Kb away from the respective transcription start
   sites ([119]Figure S2), a distance that is in accordance with the
   concept that 80% of known promoter and enhancer interactions occur in a
   window of <320 Kb, as calculated by the analysis of Hi-C data
   [[120]45]. Based on this notion, SEV-VL30s that reside in cCREs have
   the potential to influence the expression of their nearby target genes.
   Following GREAT and Enrichr analysis of non-SEV VL30s, we found that
   SEV-VL30s are related to specific cellular functions, distinct from
   non-SEVs. Network analysis revealed that most SEV-VL30-related genes
   interact, and pathway enrichment analysis showed that they are
   associated with developmental abnormalities and neoplasia.

   Our results agree with the conceptual framework that retrotransposon
   induction is associated with the orchestration of regulatory networks,
   such as the ones observed during early human development that assist
   stem cell pluripotency [[121]46]. The balance between the induction of
   abnormalities and the establishment of novel regulatory networks is
   also consistent with this notion, suggesting an interaction with the
   host that includes cycles of restraint and rehabilitation [[122]47].
   The potential of targeting the genome of the cell in which VL30 lncRNA
   is derived as well as the genomes of other cells, through efficient
   enrichment in SEVs, represents a novel paradigm of interaction with the
   host, with many exciting implications for non-coding RNA biology.

Supplementary Materials

   The following are available online at
   [123]https://www.mdpi.com/article/10.3390/biomedicines9111742/s1,
   Figure S1: SEV-VL30s in the phylogenetic tree of the Mus genus. Figure
   S2: Distance of SEV-VL30s to mouse genes promoters. Figure S3: Distance
   of VL30 elements not associated with SEVs (non-SEV VL30s) to mouse
   genes promoters, following GREAT analysis. Figure S4: Enrichment for
   mammalian phenotypes in genes related to SEV-VL30s. Figure S5:
   Enrichment for mammalian phenotypes in genes related to to non-SEV
   VL30s. Table S1: Structural features of SEV-VL30s.
   [124]Click here for additional data file.^ (503.3KB, zip)

Author Contributions

   Conceptualization, G.S.M.; methodology, G.S.M.; validation, S.M. and
   G.S.M.; formal analysis, S.M. and G.S.M.; investigation, S.M. and
   G.S.M.; data curation, S.M. and G.S.M.; writing—original draft
   preparation, S.M. and G.S.M.; writing—review and editing, S.M. and
   G.S.M.; All authors have read and agreed to the published version of
   the manuscript.

Funding

   This research received no external funding.

Institutional Review Board Statement

   Not applicable.

Informed Consent Statement

   Not applicable.

Conflicts of Interest

   The authors declare no conflict of interest.

Footnotes

   Publisher’s Note: MDPI stays neutral with regard to jurisdictional
   claims in published maps and institutional affiliations.

References