Abstract

   The cell intrinsic antiviral response of multicellular organisms
   developed over millions of years and critically relies on the ability
   to sense and eliminate viral nucleic acids. Here we use an affinity
   proteomics approach in evolutionary distant species (human, mouse and
   fly) to identify proteins that are conserved in their ability to
   associate with diverse viral nucleic acids. This approach shows a core
   of orthologous proteins targeting viral genetic material and
   species-specific interactions. Functional characterization of the
   influence of 181 candidates on replication of 6 distinct viruses in
   human cells and flies identifies 128 nucleic acid binding proteins with
   an impact on virus growth. We identify the family of TAO kinases
   (TAOK1, −2 and −3) as dsRNA-interacting antiviral proteins and show
   their requirement for type-I interferon induction. Depletion of TAO
   kinases in mammals or flies leads to an impaired response to virus
   infection characterized by a reduced induction of interferon stimulated
   genes in mammals and impaired expression of srg1 and diedel in flies.
   Overall, our study shows a larger set of proteins able to mediate the
   interaction between viral genetic material and host factors than
   anticipated so far, attesting to the ancestral roots of innate immunity
   and to the lineage-specific pressures exerted by viruses.

   Subject terms: Pattern recognition receptors, Virology, Interferons
     __________________________________________________________________

   Whether there are conserved nucleic acid (NA) binding proteins across
   species is not fully known. Using data from human, mouse and fly, the
   authors identify common binders, implicate TAOKs and show that these
   kinases bind NAs across species and promote virus defence in mammalian
   cells.

Introduction

   The innate immune system is critical to mount an appropriate defense
   response against invading pathogens. Virus infections in vertebrates
   lead to transcriptional and translational regulation of antiviral
   proteins (e.g., interferon-stimulated genes (ISGs) such as MX1, PKR,
   and IFIT proteins), to the secretion of cytokines with instructive
   functions (e.g., type-I interferons, IL-6, IL-8, and TNF) and
   alterations in the expression of cell surface proteins (e.g., MHC
   molecules)^[58]1. Among the best-studied cytokines that are involved in
   antiviral immunity are type-I interferons (IFN-α/β), a class of
   cytokines that are rapidly produced after virus engagement and that
   leads to upregulation of hundreds of proteins in an autocrine and
   paracrine manner^[59]2. It is commonly accepted that the main
   pathogen-associated molecular pattern that leads to activation of the
   innate immune system is viral genetic material, namely viral RNA and
   DNA^[60]3. These nucleic acids (NAs) are delivered into cells upon
   virus infection and are amplified during viral replication. Specific
   pattern recognition receptors (PRRs), such as membrane-bound Toll-like
   receptors (TLRs), cytoplasmic RIG-I-like receptors (RLRs), cGAS, or
   AIM2-like receptors sense viral nucleic acids and lead to the
   expression of type-I and type-III (IFN-λ) interferons, which serve as
   messengers to induce expression of antiviral proteins^[61]4. IFN-α/β
   and - λ bind to their specific cell surface receptors and induce the
   synthesis of ISGs. Importantly, besides activating PRRs, viral NAs can
   also associate with and activate the product of certain ISGs. Such
   proteins can scavenge viral genetic material (e.g., IFIT proteins),
   they can serve as co-receptors for PRRs (e.g., LGP2 and DDX41) or
   activate their enzymatic activity after viral RNA engagement to
   modulate cellular machineries (e.g., PKR, 2′5′-OAS
   proteins)^[62]3,[63]5. Thus, viral NAs trigger multiple effects in
   cells, many of which are mediated by individual proteins.

   The current understanding of how viral NAs induce antiviral immunity
   involves different scenarios. For instance, viral infections deliver
   nucleic acids into compartments that are normally NA-free. Such
   compartments can be endosomes, which are surveyed by TLRs, or the
   cytosol, which is normally free of DNA and is monitored by cGAS and
   AIM2-like receptors. Moreover, eukaryotic NAs are often heavily
   processed and bear methylated nucleotides (e.g., N7 methylation on CAP,
   2′O methylation on 5′ ribose moieties) that are co- or
   posttranscriptionally added. Lack of these modifications, through
   transcription by viral polymerases devoid of editing activity, leads to
   the accumulation of nucleic acid species that are chemically or
   structurally distinct from cellular nucleic acids. However, most
   viruses that successfully infect eukaryotes have evolved strategies to
   mimic these modifications or to block PRRs sensing the lack of these
   marks. Moreover, some viruses transport or induce NAs that serve as
   signaling molecules, which can activate proteins with antiviral
   properties, e.g. 2′5′ linked oligoadenylates (2′5′OAs) and cGAMP^[64]6.
   Besides viruses, many bacteria contain similar oligonucleotides that
   can be sensed by the innate immune system^[65]7.

   Intracellular antiviral defense systems are best characterized in
   mammals. However, discoveries of viruses in fossils underline the
   coexistence of these pathogens and their hosts over hundreds of million
   years indicating that cell-intrinsic defense mechanisms should be
   similarly ancient^[66]8. Indeed, even though the interferon system only
   evolved in vertebrates, functional studies in the model organisms
   Caenorhabditis elegans and Drosophila melanogaster demonstrated that
   certain aspects of antiviral immunity are conserved between mammals and
   invertebrates^[67]9. The D. melanogaster DEAD-box RNA helicase Dcr-2,
   for instance, is related to mammalian RIG-I and serves as an antiviral
   protein in flies^[68]10. The recent discovery of an antiviral DICER
   isoform (aviD), which is active in specialized mammalian cells, further
   underlines the conservation of antiviral mechanisms between vertebrates
   and invertebrates^[69]11. Another DEAD-box RNA helicase, DDX17, also
   acts as a cytoplasmic viral NA sensor, and both DDX17 and its fly
   orthologue, Rm62, have notable antiviral activity against Rift Valley
   Fever virus^[70]12. Similarly, the conserved dsRNA-binding enzyme ADAR
   binds viral generated double-stranded (ds)RNA and exerts adenosine to
   inosine editing activity in worms, flies, and mammals^[71]13–[72]15.
   Furthermore, identification of a functional orthologue of the human
   cytosolic dsDNA receptor cGAS in sea anemone shows that the cGAS-STING
   signaling pathway was already present >500 million years ago, predating
   the evolution of interferons^[73]16. The latter examples suggest that
   not only the editing of RNAs but also downstream functions linked to
   virus defense programs, have been conserved. Noticeably, proteins that
   proved to be useful for antiviral immunity are—at least in
   part—evolutionarily conserved and have retained ancestral properties.

   Affinity proteomics using viral NAs as baits are commonly employed to
   identify individual proteins with distinct functions in antiviral host
   defense. For example, a recently published, in-depth study of
   RNA-binding proteins (RBPome) in Sindbis virus (SINV) infected cells
   identified 247 RNA-binding proteins with differential binding during
   infection^[74]17. Similarly, cross-linking methodologies allowed for
   the detection of early viral RNA-binding proteins during Chikungunya
   virus and Influenza A virus (IAV) infection and identified ~400 viral
   NA binding proteins per virus^[75]18.

   Here, we perform affinity purifications of 17 different NAs (11 baits
   and 6 controls) in three different species (human, mouse, and fly),
   using liquid chromatography-tandem mass spectrometry (LC–MS/MS).
   Orthologues of the identified proteins were computationally compared,
   allowing the identification of cross-species-conserved NA interactors
   that retained antiviral properties throughout species evolution.
   Depletion screenings with 89 selected mammalian candidates and 92 fly
   genes followed by challenging with four viruses in human cells and five
   viruses in flies in vivo allow for cross -species comparison of pro-
   and antiviral activities in individual orthologous proteins. Among
   proteins that were identified to have evolutionary conserved functions
   were dsRNA-binding TAO kinases, which we show to be essential proteins
   for induction of the antiviral immune response in flies and humans.

Results

Proteomic identification of NA-interacting proteins in different species

   In order to identify proteins associated with NAs in different species,
   we established an affinity purification mass spectrometry (AP-MS)
   approach that allows testing for specificity to chemical or structural
   components of the different baits. Synthetic NAs were coupled to beads
   and incubated with cell lysates to precipitate NA associating proteins,
   which were then analyzed by LC–MS/MS (Fig. [76]1a)^[77]19. The bait NAs
   were chosen to resemble NAs commonly found during viral infections and
   that are known to activate or be targeted by the innate immune system:
   synthetic double-stranded (ds)RNAs (poly(I:C) and poly(A:U)), 5′
   modified in vitro transcribed dsRNA (dsRNA-PPP and dsRNA-CAP0) and 5′
   modified in vitro transcribed single-stranded (ss)RNAs (ssRNA-PPP,
   ssRNA-CAP, ssRNA-CAP0, and ssRNA-CAP1) (Supplementary
   Data [78]1)^[79]20–[80]38. As controls, we used matched NAs: poly(C),
   poly(U), dsRNA-OH, and ssRNA-OH. Additionally, we included interferon
   stimulatory DNA (ISD) (as DNA bait)^[81]39, as well as RNA:ISD (as a
   DNA-RNA hybrid), both with ssISD as a control. Lastly, the second
   messenger 2′5′ oligoadenylate (2′5′OA) was used with ATP serving as
   control.

Fig. 1. Proteomic identification of NA-interacting proteins in different
species.

   [82]Fig. 1
   [83]Open in a new tab

   a The experimental workflow of the screen to identify NA-interacting
   proteins. NA baits were coupled to agarose beads and used to
   precipitate proteins from human, mouse, and fly cell lysates, followed
   by LC–MS/MS analysis. Analysis considering enrichment, regulation
   during immune responses, and cross-species conservation led to
   candidate proteins that were tested in functional screens in human
   cells and flies. b Network analysis of significantly enriched human
   proteins (Welch’s t-test FDR <0.05) for each bait using THP-1 cells.
   Confirmed NA binders, selected candidates and conserved interactors are
   indicated, and proteins are colored according to the interacting NA
   type (red, RNA; blue, DNA; green, 2′5′OA). c Overlap between the
   enriched human NA binders and proteins identified with functional
   influence in loss of function screens testing replication of IAV
   (top)^[84]41, and proteins changing their poly-A-RNA-binding pattern in
   SINV infected cells (bottom)^[85]17. d Results of the Reactome pathway
   enrichment analysis across all significantly enriched proteins
   independent of bait depicting the top enriched pathways (lowest FDR and
   highest entities ratios as defined by the number of identified proteins
   per pathway compared to the number of known proteins in the said
   pathway). Source data are provided as a Source Data file.

   Using these 11 bait and 6 control NAs, we performed 234 individual
   affinity enrichments with lysates from humans (THP-1 cells), mouse
   (Raw264.7 cells), and D. melanogaster (total flies and Schneider S2
   cells) origin. Overall, we identified 904 human, 1214 mouse, and 1479
   fly proteins, respectively, which were significantly enriched in one or
   more affinity purifications (Supplementary Data [86]2–[87]5).

   The human dataset indicated an overall high specificity with expected
   binding patterns of known NA binders (Supplementary Fig. [88]1a). For
   instance, TREX1, which degrades IFN-stimulatory DNA (ISD)^[89]3, bound
   specifically to all three ISDs; RNA:DNA hybrids recovered Ribonuclease
   H1, a known nuclease of RNA:DNA hybrids, as well as all three members
   of the ribonuclease H2 heterotrimeric complex (RNaseH2A, RNaseH2B, and
   RNase2C)^[90]3. In addition, an expected binding pattern was found for
   the known RNA-specific PRRs RIG-I and MDA5 and proteins of the IFIT
   complex, which are specifically associated with chemically modified
   RNAs, including triphosphorylated and capped RNA baits^[91]3. The
   sensitivity and specificity of this approach was further supported by
   precipitation of RNase L only with its known ligand 2′5′OAs^[92]6. We
   further validated the AP-MS dataset by western blot confirming the NA
   interactions for selected candidates including SMARCA5 binding to
   poly(I:C) and PARP12 binding to poly(A:U) (Supplementary Fig. [93]1b).
   Interestingly, ABCF1 and ABCF3 bound to 2′5′OAs but not to ATP-loaded
   beads or dephosphorylated 2′5′OAs suggesting a phosphate-dependent
   interaction, such as known for RNase L (Supplementary Fig. [94]1b).

NA interactome enriches for functionally relevant proteins

   Across all bait/control comparisons, we identified a total of 904 human
   proteins that were enriched for one or more baits (Supplementary
   Data [95]2). Network analysis of the obtained data showed similarities
   and specificities of binding patterns for each bait (Fig. [96]1b). In
   this network, prey proteins could be discriminated by the nature of the
   bait they associate with. For instance, RNA and DNA containing baits
   are stratified in two different topologies in this network.
   Furthermore, structural baits (e.g. dsRNA) could be discriminated from
   baits with chemical modifications such as triphosphates and RNA-cap
   modifications. In line with their structural similarity, ssCAP1 and
   ssCAP0 shared a large number of interactors (n = 43). A limited number
   of proteins (n = 74) are associated with both RNA and DNA baits. Among
   them was CDKN2AIP, which has been described as a regulator of
   DNA-damage signaling through p53^[97]40 and was identified in
   genome-wide screens to modulate the growth of IAV, which generates
   PPP-RNA^[98]41.

   We intersected the binding patterns identified with RBPome in SINV
   infected cells^[99]17 and identified 96 proteins that are also present
   in our human NA interactome dataset (Fisher exact test, p value:
   2.42E-36) (Fig. [100]1c and Supplementary Data [101]6), in particular
   in the fraction of proteins precipitating with RNA. A cluster of
   proteins that was identified as AP-MS interactors and in the SINV
   RBPome includes MATR3, SFPQ, PSPC1, NONO, and RBM14. These proteins are
   members of the paraspeckle complex^[102]42, which has been linked to
   antiviral immune responses^[103]43,[104]44. SFPQ, NONO, and MATR3 have
   been shown to regulate posttranscriptional HIV-1 replication, with NONO
   directly interacting with both the HIV capsid and cGAS to impact the
   IFN response^[105]45–[106]47. Our data indicates that these proteins
   interact with viral RNA and may thereby participate in antiviral
   immunity.

   We also intersected the AP-MS data with a meta-analysis of genome-wide
   siRNA depletion datasets assessing IAV growth^[107]41 (Fig. [108]1c and
   Supplementary Data [109]6). The overlap between NA interactors and
   genes identified as IAV modulators recovered 150 proteins, which
   represents a highly significant enrichment of functionally relevant
   proteins (Fisher exact test, p value: 2.23E-11). Of these, 134 are host
   factors, 12 are restriction factors, and four are noted as both host
   and restriction factors (KHSRP, CIRBP, RRP1B, and PPAN)^[110]41. Of
   these proteins, six were previously annotated as NA binding factors
   with well-established antiviral activity (DHX15, PRKRA, EIF2AK2, IFIT2,
   POLR3B, and IFIT5). For example, PRKRA was enriched for the poly(I:C)
   bait in our affinity purification screen and was noted as a restriction
   factor for IAV. Upon binding to dsRNA PRKRA activates PKR/EIF2AK2, a
   well-described viral restriction factor^[111]15, and has been shown to
   interact with IAV polymerase acidic protein, via a yeast two-hybrid
   screen^[112]48. The majority of proteins have not been associated to NA
   binding and it is likely that the affinity to viral nucleic acid
   contributes to the functionality of these proteins.

A diverse set of functional activities is associated with NA interactors

   We performed enrichment analyses to extensively assess functions that
   were associated with the identified NA-interacting proteins. 60% of
   them were annotated as RNA and/or DNA binding (478 RNA binding, 147 DNA
   binding, and 69 bindings both) (Supplementary Fig. [113]1c). Reactome
   pathway analysis^[114]49 using all proteins significantly enriched
   during the AP-MS independent of bait identified 34 overrepresented
   pathways (FDR <5.5E-15) (Supplementary Data [115]6). Of these, the four
   with the highest number of identified proteins per pathway were
   metabolism of RNA, cellular responses to external stimuli, cellular
   response to stress, and translation (Fig. [116]1d). Other relevant
   pathways included pathways related to viral infection, in particular
   viral mRNA translation and influenza infection, further indicating that
   the proteins identified in the AP-MS analysis are relevant both for NA
   binding and cellular response to infection. Since this dataset
   identified highly redundant GO terms we implemented a functional
   enrichment analysis that alleviates GO term redundancies (see Materials
   and Methods) (Supplementary Fig. [117]1d). This analysis recovered 27
   enriched GO terms across the individual bait/control comparisons, 18 of
   which were directly related to NA processing. “Cellular response to
   exogenous dsRNA” was identified as hit for all RNA baits. Proteins
   contributing to the enrichment of this term included IFIT1 and RIG-I,
   as well as DHX9, all known NA binders with antiviral
   activity^[118]3,[119]50. DNA-directed processes were more related to
   DNA containing baits, again confirming specificity. In particular, this
   enrichment analysis highlights association of proteins that are related
   to nucleic acid degradation. For instance, “nuclear-transcribed mRNA
   catabolic processes, nonsense-mediated decay”, “mRNA stabilization”,
   and “mRNA destabilization” were associated with many RNA baits
   indicating that viral RNAs are associating with mRNA processing related
   proteins. Proteins that are related to these terms include HNRNPR,
   MOV10, and DHX36 and highlight the prominent engagement of catabolic
   processes in antiviral immunity.

   Enrichment of NA associating proteins was also reflected in enrichment
   for protein domains with annotated NA binding capability (Supplementary
   Fig. [120]1eand Supplementary Data [121]7). For example, the RRM
   superfamily (SF), an RNA-binding domain, was enriched among proteins
   identified in affinity purifications of poly(I:C), ssPPP, ssCAP0, and
   dsCAP0. Similarly, we observed that the DNA binding domains
   homeodomain, bZIP, and HLH were all enriched in the dsISD affinity
   purification. This analysis led to some unexpected enrichments such as
   enrichment of the R3H domain, which has been annotated as specific to
   ssRNA/DNA binding, in a dsRNA containing bait, (dsCAP0), and HEAT EZ
   domain in ssRNA bait (ssCAP).

Evolutionary conservation identifies antiviral proteins

   We next expanded the experimental approach to mouse (RAW263.7
   macrophages) and D. melanogaster (total flies and Schneider S2 cells).
   In mouse and fly we detected 1214 and 1480 proteins, respectively, that
   were significantly enriched for one or more baits, with a similar
   distribution of enriched proteins for the individual baits
   (Supplementary Fig. [122]2 and Supplementary Data [123]3–[124]5). The
   selective enrichment of proteins for RNA and DNA baits, which was also
   observed for the human system, suggested the similar quality of this
   dataset. The specificity of the dataset was supported by enrichment of
   individual proteins with known binding affinities. These included, for
   instance, enrichment of RNase L in 2′5′OAs, Rig in ds- and ssRNA, and
   OAS3 in poly(I:C) and poly(A:U) precipitates from mouse lysates.
   Similarly, we were able to identify a number of known NA interactors
   with reported antiviral activity in the fly (Supplementary Fig. [125]3
   and Supplementary Data [126]4–[127]5). Dcr-2, for example, was
   identified as enriched in poly(I:C) precipitates in both whole flies
   and S2 cells. Cpb20 and −80, components of the cap-binding complex,
   were binding all capped RNA baits used in both whole flies and S2
   cells. Double-stranded RNA-binding proteins DIP-1 and Loqs were
   identified in precipitates containing dsRNA baits, but not when ssRNAs
   were used.

   To identify proteins with species-conserved NA binding capability we
   compared human orthologues of the significantly enriched proteins in
   mouse and fly using the DRSC Integrative Ortholog Prediction Tool
   (DIOPT)^[128]51. Comparison of all enriched proteins, independent of
   bait specificity, identified 927 of the 2353 enriched proteins with a
   similar nucleic acid binding affinity between different species. Of the
   proteins enriched in the human affinity purification, 63% were also
   identified in mouse and 44% in flies, respectively (Fig. [129]2a and
   Supplementary Data [130]8–[131]9). Comparing the affinity enrichment
   data for individual baits across species allowed us to identify
   conserved NA binders for each bait. For example, 127 proteins were
   conserved in the poly(I:C) precipitate, six in the ssPPP, and only one
   in 2′5′OAs (Fig. [132]2b). The single 2′5′OAs interactor conserved
   across all three species was ABCF1 that belongs to the ABCF subfamily
   of the ATP-binding cassette (ABC) transporter superfamily and has an
   AAA domain, which was identified as an enriched domain for 2′5′OAs
   interactors (Supplementary Fig. [133]1e). ABCF1 has previously been
   identified as an immune-regulatory protein in various cancer
   associated^[134]52 and inflammatory conditions^[135]53 and was more
   recently shown to function as an E2 ligase as well as a regulator of
   innate immune responses^[136]54. The association of ABCF1 to 2′5′OAs
   may allow the possibility to regulate the activity of this protein and
   therefore modulate inflammatory conditions. Moreover, our data indicate
   that 2′5′OAs may have additional intracellular targets and that 2′5′OAs
   may serve as signaling hubs to modulate the activity of proteins
   besides RNase L.

Fig. 2. Conservation of NA binding across species and candidates selected for
functional experiments.

   [137]Fig. 2
   [138]Open in a new tab

   a Venn diagram of all NA-enriched proteins identified in all AP-MS
   screens. b Significantly enriched proteins bound to poly(I:C) (top),
   ssPPP (middle), and 2’5’OA (bottom), including the overlap between
   species (brown: human, red: mouse, and green: fly). Proteins enriched
   in all three species are provided in the callout circle. c Heatmap
   showing log[2] LFQ intensities of 90 candidates individually selected
   for their specificity of enrichment for individual NAs, conserved
   enrichment between species, and regulation of protein abundance after
   virus infection, as well as protein abundance in the input lysate
   (Input). ND not detected. Candidate clustering is based on Euclidian
   distance and Ward as agglomeration method.

   In order to select biologically relevant proteins, we calculated a
   score for each NA interactor. This score was based on the interaction
   strength between the bait and the protein in question, favoring less
   abundant proteins (see Materials and Methods). This was performed in
   parallel for the human and the mouse dataset, after which the 200
   proteins with the highest score were selected per bait and species. The
   highest-ranking proteins per bait were intersected between the two
   species and screened for being regulated by type-I and type-II
   interferons or association to GO terms related to NA sensing. Finally,
   this resulted in 90 candidates, which, based on their regulation and
   their affinity to NAs, showed a conserved pattern between mouse and
   human (Fig. [139]2c and Supplementary Fig. [140]4). Interestingly, many
   of the candidate proteins have only limited functional links to viral
   infection and immune regulation and were not previously known to
   interact with NAs (e.g., c8orf88, DTYMK, KIF2A, PDAP1, PDIA5, TAOK1,
   TAOK2, and VRK1).

Antiviral properties of species-conserved NA associated proteins

   To explore whether the NA purification approach enriched for proteins
   with antiviral and/or immune-regulatory functions we conducted an
   arrayed lentivirus-based CRISPR/Cas9 knockout (KO) screen in human
   THP-1 monocytes (Fig. [141]3a). To exclude toxicity effects associated
   with deletion of target genes, we performed a cell viability assay
   (Supplementary Fig. [142]5). Cells were left undifferentiated or were
   PMA-differentiated into macrophages followed by individual infection
   with luciferase-tagged vesicular stomatitis virus (VSV, non-segmented
   neg. strand ssRNA), Influenza A virus (IAV, segmented neg. strand
   ssRNA), Semliki Forest virus (SFV, pos. strand ssRNA), and
   Herpes-Simplex virus 1 (HSV-1, dsDNA), respectively. We tested the
   functionality of this screening method by depleting STAT1, a protein
   with known antiviral activity, as well as four nontargeting negative
   controls. As expected, compared to control depletion, luciferase
   signals for all viruses tested increased in STAT1 depleted cells
   (Fig. [143]3b). Among the 89 candidates tested, depletion of 64
   resulted in a significant change in luciferase activity for at least
   one virus in either the non-differentiated or differentiated cells
   (Fig. [144]3b). Depletion of 13 host factors led to reduced virus
   growth and 43 proteins served as restriction factors that led to
   increased luciferase levels upon depletion. In line with specificity
   for individual NAs, RNA-binding proteins had overall more prominent
   effects on RNA viruses.

Fig. 3. Antiviral activity of identified candidate proteins in human cells.

   [145]Fig. 3
   [146]Open in a new tab

   a Schematic of the screening strategy to test for virus-modulating
   activities of candidate proteins. THP-1 cells were infected with a pool
   of three lentiviruses expressing individual sgRNAs against the target
   protein or controls as well as CRISPR/Cas9 and selected for 16 days.
   Control: average of four pools of nontargeting sgRNAs; pos. control:
   STAT1. Cells were left undifferentiated or differentiated for 16 h with
   150 nM PMA and infected with luciferase-tagged viruses (VSV-FLuc at MOI
   0.1, IAV-GLuc at MOI 0.1, SFV-GLuc at MOI 0.1, and HSV-1-FLuc at MOI
   0.2). After 24 h the accumulation of luciferase signal was analyzed. b
   Heatmap showing the log[2] fold change of the luciferase signal in KO
   cells as compared to the control (median of the log[2](Luc[KO]/Luc[C])
   posterior distribution). The two-sided P value is defined as the
   probability that log[2](Luc[KO]/Luc[C]) is different from 0 using a
   random-effects generalized linear Bayesian model; significant changes
   (p value ≤0.05; unadjusted for multiple hypothesis testing) are
   highlighted with dots. Data represents the median of biological
   triplicates. Candidates were further categorized into DNA, RNA, and/or
   2′5′OA interacting proteins according to the results of the NA-AP-MS
   screen. Source data are provided as a Source Data file.

   This screen pointed towards a number of functional connections between
   NA affinity and specificity of antiviral activities. For instance,
   depletion of the PPP-RNA interactors NTPCR, TSEN2, and RBMS2 allowed
   higher virus growth of the PPP-RNA generating IAV while these proteins
   did not affect other viruses tested (Fig. [147]3b). Moreover, in this
   screening system depletion of the DNA interactor UHRF1, a chromatin
   modifier linked to negative regulation of IFN-β expression^[148]55,
   surprisingly promoted the growth of HSV-1, which could be in line with
   specific antiviral activity against DNA viruses and may call for
   further functional studies on this protein. Among proteins with a
   proviral activity, we identified the poly(I:C) and poly(A:U)
   associating proteins KHDRBS1, APEX1, and MKRN2 (associate with dsRNA
   and are proviral for SFV). Notably, MKRN2 has been shown to negatively
   regulate NF-κB through p65 upon LPS stimulation and depletion of MKRN2
   leads to increased IL-6 and TNF levels^[149]56. A similar function may
   be operative during viral infection explaining the decrease in viral
   load. Some proteins showed distinct activities depending on the virus
   tested. The poly(I:C) and PPP-RNA interacting proteins KIF2A and XRN1,
   for instance, appeared to be proviral for SFV, which generates high
   amounts of dsRNA, and antiviral for IAV, a PPP-RNA virus. The SFV
   proviral effect of XRN1 is in line with the phenotype observed during
   SINV infection, a virus belonging to the same family as SFV^[150]17.
   Our screen also provides insights into the differential requirement of
   proteins depending on the cellular differentiation state. Depletion of
   DDX41, a multifunctional protein and proposed DNA sensor and activator
   of the STING pathway^[151]57, for instance, led to increase of HSV-1
   growth in differentiated, but not in undifferentiated THP-1 cells
   (Fig. [152]3b). DDX41 is significantly associated with poly(I:C) and
   loss of the protein promoted growth of IAV (an RNA virus) in
   non-differentiated cells. Most interestingly, across this screen we
   identified proteins for which gene depletion led to generally increased
   virus replication, suggesting that they act as important regulators of
   the antiviral host-defense program. Prime candidates in this category
   were RSL1D1 (HSV-1, IAV, and VSV), ZFP91 (HSV-1, IAV, and VSV), and
   TAOK2 (HSV-1, SFV, and IAV). Overall, this NA interactor screen
   highlighted host factors with pro- and antiviral activity. These
   candidates were either specific to single viruses or more broadly
   active against viruses of different classes.

Functional knockdown screen in D. melanogaster identifies proteins with a
conserved antiviral function

   To enrich the functional dataset obtained in mammalian cells and to
   obtain in vivo information from living animals, we conducted an shRNA
   knockdown screen in D. melanogaster. To this aim, we selected 92
   proteins identified in the whole flies and S2 cells AP-MS screening. Of
   these, 69 were identified in both flies and S2 cells, 15 only in flies
   and 8 only in S2 cells (Supplementary Fig. [153]6), and 55 have a human
   orthologue (Supplementary Data [154]9). We used transgenic flies
   containing shRNA or inverted repeat transgenes under the control of a
   temperature-sensitive promoter, allowing temperature-inducible
   depletion of candidate genes (Fig. [155]4a). After activation of RNAi
   by temperature, the flies were infected with five well-characterized
   RNA viruses infecting arthropods (note that metagenomic analysis
   demonstrated that D. melanogaster is essentially associated with RNA
   viruses)^[156]58. The replication of the Drosophila C virus (DCV, pos.
   strand ssRNA), Cricket Paralysis virus (CrPV, pos. strand ssRNA), Flock
   House virus (FHV, pos. strand ssRNA), SINV, and VSV for 2 or 3 days was
   monitored by RT-qPCR (Fig. [157]4b). Depletion of Argonaute 2 (Ago2),
   an essential component of the RNAi pathway, and a nontargeting sequence
   (mCherry) served as positive and negative controls, respectively. Of
   the 92 fly RNAi lines, 64 showed a significant change in viral load.
   Depletion of three host factors consistently reduced virus growth and
   57 proteins served as restriction factors that upon depletion led to
   increased virus replication levels independent of the virus tested.
   Four candidate proteins were pro- or antiviral in a virus-dependent
   manner. The data allowed us to draw parallels between the NA
   association specificity and the viral replication phenotype of specific
   proteins. For example, qkr58E-1, which was identified as a poly(I:C)
   and poly(A:U) interactor had an antiviral phenotype in SINV, a virus
   known for producing large quantities of dsRNA. Along the same line,
   Rig, which was precipitated with ssCAP0, ssCAP1, and dsCAP0, has
   antiviral activity against VSV, a virus generating capped RNA through
   its own capping machinery. As in the human CRISPR/Cas9 screen, we
   identified proteins with broad antiviral effects (stau, CG5757,
   CG11505, trl, ATPsynE, CG31156, fandango). Stau, which was identified
   as poly(I:C) interactor, is a known NA binder and has not been linked
   to viral infection in fly, though we observe an increase in virus
   replication for DCV, SINV, and VSV. Interestingly, a human orthologue
   of stau, STAU1, was upregulated during SINV infection^[158]17 and has
   been shown to be involved in the viral replication of Ebola virus,
   enterovirus 71, and IAV^[159]59–[160]61, further indicating that the
   intersection of fly and human data can provide insights into NA
   interactors involved in viral interactions.

Fig. 4. RNAi knockdown and virus replication in flies.

   [161]Fig. 4
   [162]Open in a new tab

   a Experimental procedure to test antiviral activity of candidate
   proteins in flies. The fly Gal4/Gal80^TS system allows for the
   temperature-sensitive expression of sh or inverted repeat RNA. Flies
   carrying both the Gal4/Gal80 and UAS-siRNA were moved to 29 °C,
   activating Gal4 and inducing the siRNA KD. Upon confirming the
   viability of the KD flies, they were individually infected via
   injection of DCV (500 pfu/fly), FHV (500 pfu/fly), CrPV (5 pfu/fly),
   SINV (2,500 pfu/fly), and VSV (10,000 pfu/fly). Viral replication was
   measured by RT-qPCR at 2 (CrPV, DCV, FHV) or 3 (SINV, VSV) days
   post-infection. b Heatmap showing fold change of virus gene expression
   normalized to the housekeeping gene RP49 upon target protein KD as
   compared to mCherry KD flies. Data represents the mean of biological
   triplicates. Significance was calculated using lsmeans R package
   (least-squares means, linear model) with Dunnet’s adjustment for p
   values for multiple hypothesis testing. Candidates were further
   categorized into DNA, RNA, and/or 2′5′OA interacting proteins according
   to the results of the NA-AP-MS screen. Source data are provided as a
   Source Data file.

Cross-species interactome and functional KO screen identify TAO kinases as
antiviral proteins

   The NA interaction and knockout/knockdown screens gave the opportunity
   to identify proteins that are functionally conserved across species and
   that are required for antiviral immunity. Comparison of the interactome
   in human, mouse and fly as well as the functional data obtained in
   human cells and flies, highlighted TAO kinases (TAOKs), a family of
   Ste20p-related serine/threonine kinases, as potential examples of
   antiviral proteins with conserved functions. The NA interaction screen
   shows specificity of TAO kinases to dsRNA since these proteins were
   enriched in poly(I:C) (in human, fly) and poly(A:U) (mouse)
   precipitates. The functional screen in human cells and in flies
   indicated antiviral activity of these proteins, supporting an
   evolutionary conserved function of TAOKs. Vertebrates, including
   mammals, amphibians, and fish, express three TAO kinases, while
   invertebrates, e.g., insects and nematodes, express a single TAO
   kinase. TAO kinases are characterized by an N-terminal
   serine/threonine-protein kinase catalytic domain and a largely
   unstructured region in the C-terminus. In addition, TAOK2 bears a
   transmembrane domain^[163]62–[164]64. TAO kinases have previously been
   shown to regulate the p38 MAP kinase pathway upon UV-induced DNA damage
   through the phosphorylation and activation of MEK3/6^[165]65. Moreover,
   ectopic overexpression of TAOK2 was shown to activate apoptosis through
   activation of c-Jun N-terminal kinases^[166]66. Interestingly, an
   arginine to cysteine TAOK2 mutation in the unstructured C-terminus of
   the protein (R700C) was identified in clinical studies on patients
   suffering from generalized verrucosis, a human papillomavirus-induced
   disease^[167]67, indicating a relevant link to virus infections. All
   three human TAO kinases showed antiviral activity against IAV
   infection, with TAOK2 also being antiviral against SFV and HSV-1
   (Fig. [168]3b). The fly orthologue of all three human TAO kinases, Tao,
   was antiviral against DCV and VSV (Fig. [169]4b). Tao is an essential
   gene in D. melanogaster and its silencing led to a lethal phenotype
   within 3–14 days (Supplementary Fig. [170]7a), which did not allow
   long-term virus challenge experiments in vivo.

   To validate AP-MS results, we applied co-immunoprecipitation followed
   by western blotting confirming the association of human TAO kinases
   with poly(I:C), but not poly(C), and verifying the requirement of dsRNA
   in this interaction (Fig. [171]5a). The control protein β-actin did not
   associate with poly(I:C) or poly (C), respectively. To elucidate
   whether the interaction between the TAO kinases and poly(I:C) is
   direct, we generated recombinant D. melanogaster Tao kinase (dTao) in
   insect cells and examined its interaction with poly(I:C) in a
   fluorescent quenching assay using a microscale thermophoresis. Indeed,
   dTao is associated directly with fluorescently labeled poly(I:C) with a
   K[D] in the nanomolar range (42 ± 15.66 nM) (Fig. [172]5b), while
   denatured dTao did not show any interaction (Supplementary
   Fig. [173]8a). To test whether the kinase activity of dTao may be
   affected by dsRNA binding we evaluated its kinase activity in vitro in
   the presence or absence of poly(I:C). Notably, the addition of
   poly(I:C) led to a significant increase of dTao activity
   (Fig. [174]5c). Poly(I:C) itself did not affect the activity of the
   kinase assay. These data indicate that dTao kinase activity is
   modulated by poly(I:C), indicating a functional consequence of this
   interaction.

Fig. 5. Drosophila Tao activity is regulated by poly(I:C) binding and human
TAOK2 affects ISG expression.

   [175]Fig. 5
   [176]Open in a new tab

   a THP-1 cell lysate was incubated with poly(I:C) or poly(C) agarose
   beads and input proteins or co-precipitating proteins were analyzed by
   western blotting against the indicated proteins. b Fluorescence
   quenching assay showing fluorescence elicited from FITC-tagged
   poly(I:C) in presence of increasing concentrations of dTao. Shown are
   the mean fluorescence intensity ±SD of three measurements. The
   indicated K[d] was determined using Affinity Analysis v2.2.4
   (NanoTemper Technologies). c Increasing amounts of dTao (50 and
   200 ng/ml) were incubated or not with 0.3 mg/ml poly(I:C) and kinase
   activity was measured by a luminescence-based ATP consumption assay.
   Bars show the mean of three independent measurements ±SD.
   ****p < 0.0001, ***p < 0.001, ns p > 0.05 (Two-way ANOVA with Šídák’s
   multiple comparison test). AU arbitrary units. Data presented in (a, b,
   c) is representative of at least three independent experiments. (d, e,
   f) THP-1 KO or nontargeted control cells were seeded and infected with
   SFV (MOI 10) for 24 h and analyzed for proteome expression. Volcano
   plots show protein expression patterns of SFV-infected TAOK1 (e), TAOK2
   (d), and TAOK3 (f) KO cells as compared to controls. Proteins with
   significantly different expression patterns are highlighted in blue,
   proteins belonging to the GO Term “cellular response to type-I
   interferon” are marked in orange and viral proteins in green. Data
   presented in (d, e, f) is averaged across four biological repeats; a
   two-sided Student’s t-test (S0 = 0.1, permutation-based FDR <0.05) was
   used to assess the significance. g, h THP-1 KO and nontargeted control
   cells (green: control, orange: TAOK1 KO, blue: TAOK2 KO, purple: TAOK3
   KO, red: STAT1 KO) were seeded and infected with SFV (MOI 1) or left
   uninfected (Mock) for 24 h and analyzed for SFV RNA and MX1 mRNA
   transcript levels by RT-qPCR. Shown are the transcript levels
   normalized to the expression of the housekeeping gene GAPDH for four
   independent repeats expressed as fold change compared to the averaged
   biological repeats of the control. Error bars show the mean ± SD.
   ****p < 0.0001 (One-way ANOVA (g) or two-way ANOVA (h) both with
   Šídák’s multiple comparison test). ns not significant. Data presented
   in (g, h) is representative of three independent experiments. Source
   data are provided as a Source Data file.

Loss or inhibition of TAOK2 leads to a reduction of ISG expression and
increases viral growth

   To gain a deeper understanding of the functionality of TAO kinases in
   the context of virus infection, we applied full proteomic analysis
   using SFV-infected wild-type (wt) and TAOK1, -2, or -3 KO THP-1 cells
   (Supplementary Fig. [177]8b). These analyses allowed to evaluate the
   protein expression patterns of 5272 proteins in parallel and to assess
   the influence of TAOKs on the proteome. Compared to controls, depletion
   of all TAOKs led to significantly changed protein expression profiles
   after SFV infection with the most prominent effect being observed after
   depletion of TAOK2 (Fig. [178]5d–f and Supplementary Data [179]11). In
   particular, in TAOK2 KO cells, we could observe a decreased expression
   of proteins involved in the antiviral immune response, such as MX1,
   MX2, OAS3, and IFIT1, which was accompanied by an increased abundance
   of viral proteins (Fig. [180]5d). Similar regulation of MX1, as well as
   viral protein expression, was also observed for SFV-infected TAOK1 and
   TAOK3 KO cells (Fig. [181]5e, f). Indeed, GO term analysis based on
   differentially regulated proteins in SFV-infected TAOK2 KO cells showed
   a enrichment for the terms “cellular response to type-I interferon” and
   “type-I interferon-mediated signaling pathway” (Fisher exact test,
   Benjamini–Hochberg FDR <0.05). Unbiased upstream promoter
   analysis^[182]68 performed on all proteins that failed to be
   upregulated in SFV-infected TAOK2 KO cells as compared to control
   cells, further indicated eight potentially linked transcription factor
   binding sites, including the ones for STAT1, IRF1, and STAT2
   (Supplementary Fig. [183]8d). We independently validated the proteomics
   analysis testing for accumulation of SFV RNA and MX1 in THP-1 cells
   lacking TAOK1, -2, -3 or the control protein STAT1 (Fig. [184]5g, h).
   Indeed SFV RNA accumulated to significantly higher levels in cells
   lacking TAOKs with a particular increase in TAOK2 deficient cells
   (Fig. [185]5g). At the same time, MX1 mRNA transcripts were
   significantly reduced upon individual KO of all three TAOKs
   (Fig. [186]5h). Of note, even though the depletion of TAO kinases
   showed a prominent effect, the depletion of individual TAO kinases did
   not reach the same magnitude of effect as compared to STAT1 depletion,
   which could be due to redundant effects of the individual TAO kinases.
   We evaluated whether the function of TAO kinases is conserved in
   Drosophila using an in vivo virus challenge model. To this aim, we
   infected control flies or flies with two different shRNAs targeting Tao
   with DCV for 2 days and monitored for expression of the virus response
   genes srg1 and diedel. As expected, compared to control injections,
   expression of both genes was significantly induced in wt flies injected
   with DCV (Supplementary Fig. [187]7b, c). Notably, we could not observe
   significant induction of srg1 or diedel in the two Tao knockdown flies.
   In conclusion, this analysis indicated that the function of TAOKs is
   conserved between invertebrates and vertebrates and that TAOK2 is
   particularly critical for antiviral protein expression and/or antiviral
   signaling cascade regulation in human cells.

TAOK2 is involved in cytokine induction in response to SFV

   To further study the ability of TAOK2 in inducing innate immune
   responses, we confirmed its antiviral function against SFV expressing
   mCherry (SFV-mCherry) using fluorescence time-lapse microscopy
   (Fig. [188]6a). Quantification of the fluorescence signal showed that
   during the initial stages of infection, loss of TAOK2 and STAT1 lead to
   a comparable increase of virus production, which throughout the
   experiment stayed significantly higher than in control cells,
   confirming a prominent antiviral activity of TAOK2. Indeed, western
   blot analysis of SFV-infected TAOK2 KO and STAT1 KO cells indicated
   undetectable levels of MX1 while this protein was highly induced in
   control cells (Fig. [189]6b). To evaluate whether the inability to
   induce MX1 is due to IFN-α/β induction or type-I IFN signaling, we
   stimulated TAOK2 KO, STAT1 KO, and control cells with recombinant
   type-I interferon (IFN-α B/D). As expected, STAT1 deficient cells did
   not induce MX1, while expression of MX1 was similar in both TAOK2 KO
   and control cells (Fig. [190]6b) indicating that signaling downstream
   of the interferon receptor is fully intact in TAOK2 KO cells and that
   the failure to induce ISGs may be related to a defect in type-I
   interferon induction. To further corroborate these data and to gain
   additional quantitative and kinetic information on the induction of
   antiviral genes, we employed an A549-based reporter cell line that
   expresses GFP under control of the interferon-responsive IFIT1 promoter
   (A549-IFIT1-GFP), which was depleted for TAOK2 or STAT1 (Supplementary
   Fig. [191]8c). Compared to control-targeted cells, TAOK2 KO
   A549-IFIT1-GFP cells expressed significantly reduced amounts of GFP in
   response to SFV, confirming a defect in the type-I interferon induction
   or signaling (Fig. [192]6c, d). When using interferon-inducing
   poly(I:C) for stimulation experiments, we also found a significant
   requirement of TAOK2 to express IFIT1-driven GFP, indicating that the
   antiviral interferon system was affected by the loss of TAOK2
   (Fig. [193]6e). Notably, wt and TAOK2 KO A549-IFIT1-GFP cells responded
   similarly when stimulated with RIG-I activating triphosphorylated RNA
   (IVT4) or by transfection of the signaling molecule MAVS (Supplementary
   Fig. [194]8e), which indicates the specificity of TAOK2 to poly(I:C)
   and is in line with the affinity of TAOK2 to long dsRNA. As for THP-1
   cells, IFN-α B/D treatment of A549-IFIT1-GFP cells led to a similar
   expression of GFP in both, control and TAOK2 deficient cells
   (Fig. [195]6f), confirming that IFN signaling is not affected in TAOK2
   KO cells.

Fig. 6. TAOK2 is required for IFN induction in infected and poly(I:C)
stimulated cells.

   [196]Fig. 6
   [197]Open in a new tab

   a THP-1 cells were infected with SFV-mCherry (MOI 5) and red
   fluorescence intensity was measured every 3 h using an Incucyte S3
   live-cell imaging system. The line diagrams show the mean integrated
   red intensity/cell confluence per image (RCU) ± SD (y-axis) over time
   (x-axis). b Nontargeted control (Control), TAOK2 KO, or STAT1 KO THP-1
   cells were left unstimulated (Mock) or stimulated with SFV (MOI 5) or
   IFN-α B/D (1000 units/mL) for 24 h and used for western blotting
   against the indicated proteins. c Nontargeted control (Control), TAOK2
   KO, or STAT1 KO A549-IFIT1-eGFP cells were infected with SFV (MOI 5)
   and green fluorescence intensity was measured at the indicated time
   points using an Incucyte S3 live-cell imaging system. Mean green
   intensity/cell confluence per image (GCU) ± SD (y-axis) is shown over
   time (x-axis). d Representative fluorescence microscopy images of (c)
   24 h after infection with SFV. e, f as (c) but transfected with
   poly(I:C) (2 µg/mL) (e) or stimulated with IFN-α B/D (1000 units/ml)
   (f). Control cells are colored in green, TAOK2 KO cells in blue, and
   STAT1 KO cells in red. g A549-IFIT1-eGFP cells were infected with
   SFV-mCherry (MOI 5) and simultaneously treated with the TAOK2 inhibitor
   RAF265 (500 nM, blue), BRAF inhibitor Dabrafenib (500 nM, red), or left
   untreated (green). Green (GCU) and red fluorescence (RCU) intensities
   were measured at the indicated time points using an Incucyte S3
   live-cell imaging system. Mean green or red intensity/cell confluence
   per image (G/RCU) ± SD (y-axis) is shown over time (x-axis). h
   A549-ACE2 cells were treated with the TAOK2 inhibitor RAF265 (10 µM)
   and infected with SARS-COV-2-GFP (MOI 3) and accumulation of GFP was
   measured over time in an Incucyte S3 system. Line diagrams show the
   mean green intensity/cell confluence per image (GCU) ± SD (y-axis) over
   time (x-axis). Data presented in (a–h) is representative of three
   independent experiments and for each line diagram, the mean ± SD are
   plotted based on at least four biological repeats. ****p < 0.0001,
   ***p < 0.001, **p < 0.01, *p < 0.05, ns p > 0.05 (Repeated measurements
   two-way ANOVA with Šídák’s multiple comparison test to compare control
   versus treatment conditions). Source data are provided as a Source Data
   file.

   Kinases are commonly targeted for pharmacological interventions in a
   variety of diseases. We mined a kinase inhibitor-wide database for
   potential drugs that modulate the activity of TAOK2. A mass
   spectrometry-based screening approach identified RAF265 as a TAOK2
   inhibitor^[198]69. RAF265 was originally identified as a BRAF
   inhibitor, and mouse experiments indicated potential use of RAF265 in
   cancer treatment^[199]70, however, the BRAF status of patients did not
   correlate with treatment efficacy indicating that this drug has
   additional targets^[200]71. We applied RAF265 to A549-IFIT1-GFP cells
   and infected them with SFV-mCherry to study whether this drug would
   affect virus growth or influence the expression of GFP. RAF265
   treatment led to a significant increase in SFV-mCherry growth,
   particularly at later times of infection (Fig. [201]6g). At the same
   time, IFIT1-GFP expression was reduced in RAF265 treated cells
   (Fig. [202]6g), similar to the phenotype previously observed in the
   TAOK2 KO cells. To exclude a potential effect of BRAF in this system,
   we treated A549-IFIT1-GFP cells with the established BRAF inhibitor
   Dabrafenib and infected these cells with SFV-mCherry. Dabrafenib did
   not affect SFV-mCherry growth or IFIT1-GFP expression, indicating that
   BRAF inhibition was not responsible for the phenotype observed upon
   RAF265 treatment. We evaluated whether the effect of RAF265 was
   dependent on TAOK2 by stimulating A549-IFIT1-GFP wt and TAOK2 KO cells
   with SFV and monitored the effect of the inhibitor on IFIT1-GFP levels.
   While RAF265 significantly reduced IFIT1-GFP expression in wt cells,
   the inhibitor was much less active in TAOK2 KO cells, further
   validating that RAF265 operates in a TAOK2 specific manner
   (Supplementary Fig. [203]8f). To underline the relevance of TAOKs upon
   infection with a human-relevant pathogen, we investigated the effect of
   RAF265 on SARS-CoV-2, a positive ssRNA coronavirus that generates large
   amounts of dsRNA during virus infection^[204]72. Treatment of A549-ACE2
   overexpressing cells with RAF265 followed by infection with
   SARS-CoV-2-GFP showed an increase of viral replication compared to the
   negative control (Fig. [205]6h), indicating an involvement of TAOKs in
   antiviral immunity against a wide variety of viruses. Moreover, it
   indicates that the antiviral activity of TAOKs can be pharmacologically
   targeted.

Loss of TAOK2 impacts IFN-α/β expression but has little effect on
pro-inflammatory cytokines

   Having noted a distinct lack of upregulation of ISGs in SFV-infected
   TAOK2 deficient cells, but a functional ISG response to recombinant
   IFN, we hypothesized that TAOK2 is active within a PRR signaling
   pathway. Since PRR signaling results in cytokine expression, we
   assessed the expression of cytokines in supernatants of SFV-infected
   THP-1 TAOK2 KO and control cells using a cytometric bead array and
   ELISA. Indeed, we observed a significant decrease in induction of IFN-β
   and IP-10 in cells that lacked TAOK2 as compared to control cells
   (Fig. [206]7a, b). A similar deficiency was seen for the cytokines
   MCP-1 and MIP-1b (Fig. [207]7c, d). MCP-1 and MIP-1b are both
   pro-inflammatory chemokines and chemo-attractants and induced via NF-κB
   and IRF3 activation or IFN-α/β stimulation,
   respectively^[208]73,[209]74. Surprisingly, compared to controls, TAOK2
   KO cells did not produce less IL-6, IL-8, and TNF in response to SFV
   (Fig. [210]7e–g), indicating that TAOK2 is not required to induce the
   expression of pro-inflammatory cytokines. The congruence of the lack of
   upregulation of ISGs and the decrease in IFN levels upon infection
   clearly indicates that TAOK2 is involved in the IFN production pathway
   and points towards the involvement of TAOK2 in IRF3-dependent cytokine
   expression (IFN-β and IP-10). Similarly, compared to control THP-1
   cells, deletion of TAOK1 and -3 also led to a significant decrease of
   IFN-β and IP-10 protein secretion upon SFV infection (Supplementary
   Fig. [211]8g, h), indicating a nonredundant role of all TAO kinases for
   induction of IRF3-dependent cytokines.

Fig. 7. Loss of TAOK2 directly impacts IFN-α/β secretion.

   [212]Fig. 7
   [213]Open in a new tab

   a–g THP-1 control (green) or TAOK2 KO (blue) cells were infected with
   SFV at the indicated MOI and 24 h later the accumulation of cytokines
   in the supernatant was measured by ELISA (IFN-β (a) and IP-10 (b)) and
   cytometric bead array (MCP-1/CCL2 (c), MIP-1b/CCL4 (d), TNF (e), IL-6
   (f), and IL-8 (g)). Data presented is averaged across four biological
   repeats with mean ± SD. ****p < 0.0001, ***p < 0.001, **p < 0.01,
   *p < 0.05, ns p > 0.05 (Two-way ANOVA with Šídák’s multiple comparison
   test). Source data are provided as a Source Data file.

TAOK2 interacts with TRIM4, a known enhancer of RIG-I-dependent innate immune
responses

   To identify a molecular link between sensing of dsRNA and the
   activation of innate immune responses, we used AP-MS to identify
   cellular binding partners of TAOK2^[214]75. To this aim we transfected
   HEK293T cells with control proteins (GFP and human PGAM5), C-terminal
   transmembrane domain deleted V5-tagged wild-type rat TAOK2 (which is
   highly similar to human TAOK2), rat TAOK2 D151A (mutation in the active
   site of the kinase domain), and rat TAOK2-R702C corresponding to human
   R700C (a clinical variation identified in human papillomavirus-driven
   generalized verrucosis). The transfected cells were either mock-treated
   or stimulated with poly(I:C), the V5-tagged proteins were precipitated
   and then analysed by mass spectrometry. Among the candidates that were
   identified to significantly associate with precipitated wt TAOK2 were
   proteins linked to already described functions of TAOK2, such as MAPK
   signaling (e.g., BRAP, PDCD10, WDR83, and YWHAB) and cell death (e.g.,
   BAG1, BCLAF1, CHD8, STK3, and USP24). Intriguingly, besides expected
   proteins, TAOK2 specifically enriched for four functionally connected
   ubiquitin ligase proteins, TRIM4, TRIM21, FBXO30, and HECTD1
   (Fig. [215]8a, Supplementary Fig. [216]9a, and Supplementary
   Data [217]12). While the co-enrichment of TRIM4, FBXO30, and HECTD1
   could be detected in both mock and poly(I:C)-treated cells, their
   association to TAOK2 was more pronounced and only significant upon
   poly(I:C) stimulation. TRIM4, in particular, has been shown to be a
   critical mediator for IFN-α/β induction and is known to mediate the
   K63-linked ubiquitination of RIG-I^[218]76 and could explain the effect
   of TAOK2 on type-I IFN induction in SFV-infected cells (Fig. [219]8b
   and Fig. [220]5d–h). The TAOK2 mutation in the active site of the
   kinase domain (D151A) greatly decreased the number of interactors,
   particularly association to proteins involved in the regulation of
   transcription (e.g., ASF1A, LRRFIP, and BEND3), but not to proteins
   related to MAPK signaling (e.g., CAMK2G, WDR83, and YWHAB)
   (Supplementary Fig. [221]9b). Notably, wt TAOK2 and TAOK2 D151A
   precipitated TRIM4 to a similar extent. Strikingly, the association of
   TRIM4 to TAOK2 was significantly reduced in the TAOK2-R702C mutant, the
   TAOK2 variant identified in immunodeficient patients suffering from
   uncontrolled generalized verrucosis (Fig. [222]8c)^[223]67.

Fig. 8. TAOK2 interacts with TRIM4, a known enhancer of RIG-I-dependent
innate immune responses.

   [224]Fig. 8
   [225]Open in a new tab

   a Scatter plot showing the log[2] fold change enrichment of proteins
   following affinity purification of rat TAOK2 as compared to the
   combined control (CTRL) baits (PGAM5 and EGFP) in mock (x-axis) and
   poly(I:C) stimulated (y-axis) HEK293T cells. Significantly enriched
   proteins were identified by a two-sided Student’s t-tests
   (permutation-based FDR <0.05), further filtered to show a log[2] fold
   change of ≥1.5, and colored in blue (only significant in mock), orange
   (only significant upon poly(I:C) stimulation), red (significant in mock
   and upon poly(I:C) stimulation), or black (nonsignificant or
   significant but a log[2] fold change <1.5). Node size corresponds to
   the −log[10] p value of a given bait versus control comparison and the
   node size for red-colored proteins is averaged between the two TAOK2
   versus CTRL comparisons for mock and poly(I:C) stimulation. b STRING
   enrichment of rat TAOK2 interacting proteins in mock and poly(I:C)
   stimulated cells identified a functionally connected ubiquitin ligase
   complex, including TRIM4, an enhancer of type-I IFN responses by
   mediating RIG-I ubiquitination. c Scatter plot comparing the log[2]
   fold change enrichment of proteins following affinity purification of
   wild-type rat TAOK2 (x-axis) versus rat TAOK2-R702C (y-axis) in
   poly(I:C) stimulated HEK293T cells. Significantly enriched proteins
   were identified by a two-sided Student’s t-tests (permutation-based FDR
   <0.05), further filtered to show a log[2] fold change of ≥1.5, and
   colored in yellow (only significant in wild-type TAOK2 with a log[2]
   fold change difference ≥1 between wild-type and R702C-mutated TAOK2
   affinity purifications), orange (only significant in TAOK2-R702C with a
   log[2] fold change difference ≥1 between R702C-mutated and wild-type
   TAOK2 affinity purifications), red (significant in both wild-type and
   R702C-mutant TAOK2), or black (nonsignificant, significant but a log[2]
   fold change <1.5, or significant and a log[2] fold change ≥1.5 but an
   absolute log[2] fold change difference <1 between wild-type and
   R702C-mutated TAOK2 affinity purifications). Node size corresponds to
   the absolute log[2] fold change difference of a given protein between
   wild-type and R702C-mutated TAOK2 affinity purifications. Log[2] fold
   change difference values for each protein were normalized by the log[2]
   fold change difference of TAOK2 to account for differences in
   enrichment efficiencies between the two TAOK2 variants.

   Overall, TAOK2 was identified in this study as a species-conserved
   dsRNA-binding protein involved in antiviral immunity. Lack of TAOK2
   significantly altered IFN-α/β induction, subsequent ISG expression and
   hence promoted viral growth. Unbiased proteomics analysis identified
   TRIM4, a known ubiquitin ligase with the ability to regulate RIG-like
   receptor signaling, as a prominent binding partner of TAOK2, which
   potentially links TAOK2 activation to the type-I IFN pathway.

Discussion

   The eukaryotic innate immune system coevolved under the selective
   pressure of viruses over millions of years, which resulted in conserved
   eukaryotic proteins dedicated to antiviral immunity^[226]8,[227]77. We
   used affinity enrichment with viral NAs in distantly related species to
   identify conserved NA interactors, hypothesizing that these proteins
   may have preserved antiviral functions related to their NA interaction.
   These functions could include PRRs, like TLR3 and RIG-I, which detect
   viral NAs and induce cytokine expression, NA receptors with direct
   antiviral activity, e.g., PKR, which directly interferes with viral
   translation, or PRR cofactors, e.g., IFI16, which facilitates cGAS
   activity^[228]3,[229]78. NA binding proteins might also have multiple
   or alternative functions, for example, the TLR7/TLR9 cofactor CD14 also
   enhances the cellular uptake of specific nucleic acids, promoting
   delivery to the respective TLR^[230]79.

   Affinity proteomics of NAs proved to be successful for proteins that
   bind viral NAs with high affinity, though it is less suited to identify
   functionally relevant proteins with limited affinity for viral NAs. For
   example, 5′ triphosphate RNA (PPP-RNA) associated with high affinity to
   IFIT proteins, which appear to act as scavenging factors^[231]19. The
   established PPP-RNA sensor RIG-I is identified with much lower
   enrichment scores. Moreover, an additional complication is that some
   proteins identified by affinity proteomics are not specific to a
   certain bait and also show binding affinity to a variety of different
   baits. Single AP-MS experiments, therefore, need to be carefully
   controlled and allow only partial insights into the specificities for
   individual viral NAs. Overall, we identified a set of conserved
   interactants, underscoring the ancient origins of antiviral innate
   immunity^[232]80, together with a number of species-specific
   candidates, reflecting differences in the evolutionary trajectories of
   antiviral immune systems in organisms independently confronted to
   specific viruses^[233]81. Our results provide a useful resource for
   future functional studies and highlight the potential of the approach,
   which could be used with other species (e.g., other vertebrates, vector
   mosquitoes, and nematodes) to provide broader phylogenetic
   perspectives.

   CRISPR/Cas9 mediated depletion of a selected subset of NA interactors
   demonstrated antiviral activity against different viruses tested, which
   could partially be explained by their distinct affinity to nucleic
   acids. Such an example may be PARP12, a member of the protein family
   Poly-ADP-Ribose Polymerases, which we identified as poly(A:U)
   interactors in humans and mouse. Its association with RNA may be
   explained by four CCCH-type zinc finger motifs, which are known to be
   involved in nucleic acid binding of other PARP proteins^[234]82. PARP12
   depletion led to increased replication of IAV in human cells and has
   previously been shown to be active against VSV, Murine gammaherpesvirus
   68 (MHV-68), Venezuelan equine encephalitis virus, and Zika
   virus^[235]83–[236]85. Although some of the antiviral activity of
   PARP12 has been linked to its ability to specifically target virus
   proteins, such as degradation of Zika virus NS1 and NS3
   proteins^[237]83, the broad activity against many viruses may be
   explained by its affinity for nucleic acids.

   Our data may not only contain proteins with direct links to viral
   genomic nucleic acids but also candidates that become active during
   virus infection or during the innate antiviral response. RSL1D1 (also
   known as CSIG) was in our study identified as a DNA binder and is known
   for its involvement in the DNA damage response (DDR) after UV
   irradiation^[238]86. Despite its restricted affinity for DNA, we
   observed a broad antiviral activity against DNA (HSV-1) and RNA viruses
   (IAV, VSV), but this could very well be explained by the RSL1D1
   dependent induction of DDR since all the above viruses have the ability
   to induce DNA damage during the infection process^[239]87. RSL1D1
   furthermore regulates translation of the signaling protein
   PTEN^[240]88, which negatively regulates PI3K signaling and could
   thereby influence the antiviral response to RNA
   viruses^[241]89,[242]90.

   Orthologue comparison of the human NA interactors to the interactors
   identified in fly and mouse provides information regarding evolutionary
   conservation and helps to pinpoint proteins for further investigation
   on a mechanistic level. Besides known conserved interactors, such as
   DICER1 (binding to poly(I:C)), a member of the RNA-induced silencing
   complex which posttranscriptionally silences genes both in humans and
   fly, we also identified less well-studied interactors as proteins with
   conserved affinity for viral NAs. For instance, both human and mouse
   SMARCA5 and their fly orthologue ISWI were identified in the poly(I:C)
   affinity purification. SMARCA5, a member of the SWI/SNF protein family,
   which is best known for its involvement in chromatin remodeling
   processes, showed an antiviral effect against VSV, IAV, and HSV-1 in
   human cells. While SMARCA5 has been studied in the context of cell
   invasion and migration in cancer^[243]91, it has not yet been linked to
   antiviral immunity in humans. Interestingly, the mouse orthologue
   SMARCA5 was identified as a retroviral element silencer, and the fly
   orthologue ISWI has also been shown to interact with RNA and is
   upregulated during SINV infection^[244]92–[245]94. We here identified
   SMARCA5 as an antiviral protein with conserved RNA-binding capability
   and antiviral activity, potentially pointing towards conservation of
   its function in distantly related species. SMARCA2 and SMARCA4, two
   other members of the SWI/SNF family, are differentially expressed
   during viral infection and regulate responses to poly(I:C)^[246]95 and
   SMARCA2 impairs IAV growth^[247]96. In sum, this highlights how the
   SWI/SNF family could shape antiviral immunity while further studies may
   be warranted in the future.

   Based on the NA affinity screen and candidate selection we identified
   14 proteins that influenced virus growth in flies in vivo and in human
   cells in vitro (Fig. [248]9a). Some of these proteins shared
   affinities, functions, and known involvement in conserved signaling
   pathways. For instance, MSI2 and CDKN2AIP identified to interact with
   different ssRNAs and dsISD baits in fly and humans showed antiviral
   phenotypes for IAV and CrPV, and MSI2 additionally for DCV and VSV
   infection (Fig. [249]8b). Neither protein had previously been linked to
   a viral phenotype, but they are involved in the WNT-β-catenin signaling
   pathway, which has been linked to regulation of the IFN-β immune
   response in humans and to the Toll-regulated NF-κB response in
   fly^[250]97,[251]98. Four of the 14 proteins with viral phenotypes in
   both fly and human (ADARB1, APEX1, ILF2, and KHDRBS1) showed
   contrasting effects in the functional screens. KHDRBS1 depletion
   reduced virus replication during SFV infection and is a proviral host
   factor for HIV-1, Foot-and-mouth disease virus, and Hepatitis C
   virus^[252]99–[253]101. Surprisingly, KHDRBS1 depletion in flies led to
   an increase in viral replication for both CrPV and SINV. It is
   currently unclear how these opposing phenotypes occur in the two
   different species but may reflect differential adaptation of these
   viruses to the respective host^[254]102.

Fig. 9. Summary of screening results.

   [255]Fig. 9
   [256]Open in a new tab

   a Overlap of proteins between human (brown) and fly (green; combined
   results from drosophila and S2 cells), which were identified as NA
   binder in the AP-MS screen (LC–MS/MS), selected as candidates for
   further functional validation (Candidates) and that showed an anti- or
   proviral phenotype upon depletion (Functional screening). Orthologue
   mapping between human and fly proteins was performed using DRSC
   Integrative Ortholog Prediction Tool. b Overview of the results
   gathered in the screening approaches in humans and fly for the 28 top
   candidates (red: antiviral, green: proviral). Shown are human proteins
   with annotated orthologues in fly. *for ILF3 we observed an increase of
   viral replication in PMA treated THP-1 cells, but a decrease of viral
   replication in the untreated THP-1 cells.

   Among the most conserved candidates in terms of binding capability and
   antiviral function were the three TAO kinases, TAOK1, TAOK2, and TAOK3,
   which interacted with poly(I:C) in human and mouse cells, while the
   single fly orthologue dTao interacted with poly(I:C) and dsISD. The
   interaction between dTao and poly(I:C) was direct and of high affinity
   and intriguingly, poly(I:C) regulated dTao kinase activity in vitro,
   indicating a direct consequence of this interaction. In functional
   screens, all three human TAO kinases showed antiviral activity against
   IAV infection, with TAOK2 also being antiviral against SFV and HSV-1.
   In flies, dTao was antiviral against DCV and VSV and its depletion led
   to reduced expression of virus-induced genes in vivo. Proteomics
   analysis showed a surprising involvement of TAO kinases in the
   induction of proteins involved in antiviral immunity. Differential
   expression of proteins in infected cells, as well as cytokine
   profiling, suggest that TAOK2 deficiency leads to a selective
   impairment of IRF3-dependent cytokines such as IFN-β and IP-10.

   Interestingly, recent single-cell genomics data performed in SARS-CoV-2
   infected patients showed reduced expression of TAOK1 in SARS-CoV-2
   infected cells^[257]103, indicating that this kinase may be actively
   regulated by viruses and further underlining TAOKs as important
   positive regulators in antiviral immunity. Notably, TAOK2 mutations
   have also been identified in patients showing treatment-resistant
   generalized verrucosis lesions^[258]67, a disease caused by the
   uncontrolled growth of human papillomavirus. This clinical report
   identified a missense mutation of TAOK2 (C2098T), which causes an amino
   acid change (arginine to cysteine at position 700), in the unstructured
   region located between the kinase (28–281aa) and the transmembrane
   domain (955–1063aa). Even though papillomaviruses encode a DNA genome,
   it is well accepted that DNA viruses can generate dsRNA through
   convergent transcription which leads to activation of dsRNA-binding
   proteins such as PKR and ADAR1^[259]104. Our data suggest that the
   functional relationship between the TAOK2 mutation and the observed
   inability to control the human papillomavirus could be related to the
   innate immune regulating properties of TAOK2 upon sensing accumulation
   of dsRNA.

   As noted above, TAO kinases are highly conserved across species,
   including in the nematode C. elegans. In addition, potential
   orthologues have also been predicted in N. vectensis and A.
   queenslandica^[260]105. Looking at a broader evolutionary context, this
   suggests that TAO kinases may have evolved in parallel to TLRs and
   cGAS^[261]16,[262]106. In the context of DNA damage, G-protein-coupled
   receptor signaling, and osmotic stress, TAO kinases are known
   regulators of the MAP kinases MKK3/6 and MKK4/7, which regulate p38 and
   JNK, respectively^[263]65,[264]107. Both p38 and JNK have been linked
   to pro-inflammatory cytokine expression and interferon
   production^[265]108. Intriguingly, there is some evidence that the
   MKK4/7 – JNK signaling pathway directly and specifically regulates IFN
   production. For instance, upon loss of MKK4/7 poly(I:C) induced
   expression of IP-10 and IFN-β was reduced, while phosphorylation of the
   NF-κB regulator IκB was unaffected^[266]109. In line with this,
   treatment with the JNK inhibitor SP600125 inhibited poly(I:C) induced
   IRF3 phosphorylation and dimerization^[267]110. Activated TAOK2 may
   directly activate MKK4/7, and then specifically activate JNK and the
   cytokine response. It is also possible that TAOK2 forms a temporary
   complex with a PRR and viral NAs. Interaction with poly(I:C) increases
   TAOK2 activity, potentially leading to the phosphorylation of IFN-α/β
   inducing PRRs. Such a cofactor function would be comparable to the
   function of IFI16 in the cGAS-STING pathway^[268]78. We used AP-MS to
   identify intracellular binding partners of TAOK2. While we could not
   find evidence for the direct association of TAOK2 to pattern
   recognition receptors, we found that TAOK2 specifically interacts with
   TRIM4, an E3 ligase that has previously been shown to mediate
   K68-linked ubiquitination of RIG-I^[269]76. Notably, the association of
   TRIM4 to TAOK2 appeared to be more stable in poly(I:C) treated
   conditions and the single point mutation (TAOK2 R700C) identified in
   generalized verrucosis patients^[270]67 reduced the association between
   TAOK2 and TRIM4. It is therefore possible that TAOK2 modifies the
   activity of a PRR-regulating protein. The consequence of this
   interaction remains to be further evaluated, but it may indicate yet
   unexplored functional relationships that could be relevant for
   antiviral immunity. Poly(I:C), which is binding and activating TAOK2,
   is sensed by the PRRs MDA5 and TLR3. TRIM4, which has originally been
   found to activate RIG-I by K68-dependent ubiquitination, may also
   regulate the activity of MDA5 or TLR3. An involvement of TAOK2 and
   TRIM4 in MDA5 dependent responses is further supported by the lack of
   IFN production in TAOK2 KO cells after infection with SFV, which is an
   MDA5 activating virus. Very little is known about the regulation of E3
   ligases involved in innate immunity. However, one could speculate that
   TAOK2 regulates the activity of TRIM4 that in turn activate RIG-I,
   MDA5, or Toll-like receptor signaling through its E3 ligase activity.

   Collectively our data show that the here described unbiased NA-AP-MS
   approach is suitable to identify yet unstudied proteins that are
   relevant for antiviral immunity.

Methods

Cells, flies, viruses, and reagents

   A549-IFIT1-eGFP cells were a kind gift from Ralf Bartenschlager
   (Heidelberg University, Germany), THP-1 cells from Veit Hornung (Gene
   Center Munich, Germany), A549 cells from Georg Kochs (University of
   Freiburg, Germany), RAW263.7 cells from Thomas Decker (MFPL Vienna,
   Austria), Schneider S2 cells from Irene Ferreira, and HEK293T cells
   were purchased from ATCC (CRL-3216). THP-1 cells were maintained in
   RPMI1640 (Sigma-Aldrich), A549, and RAW cells in DMEM (Sigma-Aldrich),
   both supplemented with 10% fetal calf serum (Sigma-Aldrich) and
   antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin). If desired,
   THP-1 cells were differentiated with PMA (150 nM, Sigma-Aldrich P1585)
   upon seeding overnight before stimulation. S2 cells were maintained in
   Schneider’s medium (Biowest) supplemented with 10% fetal calf serum,
   Glutamax (Invitrogen), and antibiotics (100 U/ml penicillin, 100 µg/ml
   streptomycin). Fly cultures were grown on standard cornmeal agar medium
   at 25 °C. All flies used were Wolbachia-free.

   HSV-1 (F-strain)-F-Luc was a gift from Soren Riis Paludan (Uni Aarhus,
   Denmark), VSV-Luc from Gert Zimmer (University Bern, Switzerland),
   Influenza A SC35M NS1_2A_Gaussia_2A_NEP from Peter Reuther (University
   of Basel), SARS-CoV-2-GFP from Volker Thiel (Universität Bern),
   SFV6-2SG-Gaussia-Luc, and SFV-mCherry from Andres Merits (University
   Tartu, Estland). DCV was kindly provided by X. Jousset and M.Bergoin
   (INRA‐CNRS URA2209, St Christol‐Lez‐Alès, France).

   Firefly luciferase substrate Coelenterazine (C2230) was from
   Sigma-Aldrich. Poly(I:C) was purchased from Sigma-Aldrich (P9582),
   fluorescent poly(I:C) was purchased from InvivoGen (tlrl-picf).
   Transfection of nucleic acids and poly(I:C) was performed using
   Metafectene Pro (Biontex T040). RAF265 and Dabrafenib were both
   purchased from Cayman Chemical (CAYM16991-5 and CAYM16989-10,
   respectively). Recombinant human IFN-α B/D was a kind gift of Prof. Dr.
   Peter Stäheli.

   The following antibodies were used: mouse anti Mx1 (1:1000) was a kind
   gift form Georg Koch (University of Freiburg, Germany), mouse anti
   actin antibody (1:2500) was purchased from Santa Cruz (sc-47778), anti
   TAOK1 from rabbit (1:1000) purchased from Bethyl Laboratories
   (A300-524A-M), anti TAOK2 from rabbit (1:500) purchased from
   Sigma-Aldrich (HPA010650), anti TAOK3 from rabbit (1:1000) purchased
   from Sigma-Aldrich (HPA017160), anti ABCF1 from rabbit (1:1000)
   purchased at Aviva Sytems Biology (ARP43631_P050), anti ABCF3 from
   rabbit (1:1000) purchased at Sigma (HPA036332), anti RNase L from mouse
   (1:2000) was a kind gift from Bob Silverman, anti RSL1D1 from rabbit
   (1:1000) was purchased from Sigma (HPA043483), anti SFV core from
   rabbit (1:1000) was a kind gift from Andres Merits, anti SMARCA5 from
   rabbit (1:1000) was purchased from Sigma (HPA008751), anti STAT1 from
   rabbit (1:1000) was purchased from Cell Signaling Technology (9172),
   horseradish peroxidase (HRP)-coupled secondary antibody against mouse
   IgG (1:2000) was purchased from Sigma-Aldrich (A0168) and against
   rabbit IgG (1:5000) was purchased from Cell Signaling Technology
   (7074). The human IFN-β DuoSet ELISA was purchased from Bio-techne
   (DY814-05) and the human IP-10 OptEIA ELISA Set from BD Biosciences
   (550926). The Bio-Plex Pro Human Cytokine 17-plex was ordered from
   Bio-Rad (M5000031YV).

NA affinity purification

   Synthetic oligoribonucleotides with a 3′-terminal C6 amino linker
   matching the first 22 nucleotides of the 5′ untranslated region of
   Severe Acute Respiratory Syndrome Coronavirus HKU-39849
   [PPP-r(AUAUUAGGUUUUUACCUACCC)-NH2] and a corresponding 2′O-ribose
   methylated RNA oligomer [PPP-r(AmUAUUAGGUUUUUACCUACCC)-NH2] were
   ordered from ChemGenes Corporation (Wilmington, MA, USA) and capped as
   described previously using the m7G Capping System (CellScript). Capped
   RNA oligomers were then HPLC-purified, biotinylated with the
   biotin-N-hydroxysuccinimide ester (Epicenter) according to the
   manufacturer’s instructions, and again HPLC-purified. As a control, we
   used a corresponding 3′-terminal biotinylated and HPLC-purified
   oligoribonucleotide harboring a 5′ hydroxyl group
   [OH-r(AUAUUAGGUUUUUACCUACCCU)-biotin]. Biotinylated 2′5′OAs were
   synthesized according to the protocol described in Turpaev et
   al.^[271]111, using a RESOURCE column, biotinylated ATP was purchased
   from Perkin Elmer (NEL544001EA). Biotinylated in vitro synthesized
   PPP-RNA (7SKas RNA) was described earlier^[272]19. For quantitative
   purification of proteins binding to biotinylated synthetic or in vitro
   transcribed nucleic acids, streptavidin affinity resin was first
   incubated either with 100 pmol aliquots of biotin-labeled 7SKas RNA,
   5 nmol of RNA oligomers, 100 pmol 2′5′OAs, 100 pmol ATP or 100 pmol ISD
   in TAP buffer (50 mM Tris pH 7.5, 100 mM NaCl, 5% (v/v) glycerol, 0.2%
   (v/v) Nonidet-P40, 1.5 mM MgCl2, and protease inhibitor cocktail
   (EDTA-free, cOmplete; Roche)) in the presence of 40 U RNase inhibitor
   (Fermentas) for 60 min at 4 °C on a rotary wheel. Poly(C) (Sigma P9827)
   or poly(U) (Sigma P8563) agarose beads (20 µl bed volume) were either
   incubated with excess poly(I) (Sigma P4154) or poly(A) (Sigma P9403),
   respectively, or left untreated. Beads were washed three times with TAP
   buffer to remove excess unbound nucleic acids. Cell lysates from mouse
   RAW macrophages, human THP-1 macrophages, and drosophila S2 cells were
   prepared by flash-freezing cells in liquid nitrogen, followed by lysis
   in TAP buffer for 30 min on ice. Whole flies were mixed with TAP buffer
   and lysed by bead milling using the FastPrep-24 (MPBio) with Lysing
   Matrix D (MPBio) at 5500 rpm two times for 25 s. Lysates were clarified
   by centrifugation at 16,000×g for 10 min. Nucleic acid-coated beads
   were incubated with 2 mg protein of cell lysates for 60 min, washed
   three times with TAP buffer, and twice with TAP buffer lacking
   Nonidet-P40 to remove residual detergent. Four independent affinity
   purifications were performed for each bait. Following affinity
   purification, bound proteins were denatured by incubation in U/T
   denaturation buffer (6 M urea, 2 M thiourea, 1 mM DTT (Sigma), 10 mM
   HEPES, pH 8) for 30 min and alkylated with 5.5 mM iodoacetamide (Sigma)
   for 20 min. After digestion through the addition of 1 µg LysC (WAKO
   Chemicals USA) at room temperature for 3 h, the suspension was diluted
   in 50 mM ammonium bicarbonate buffer (pH 8). The beads were removed by
   filtration through 96-well multiscreen filter plates (Millipore,
   MSBVN1210), and the protein solution was digested with 0.5 µg trypsin
   (Promega) overnight at room temperature. Peptide purification based on
   C18 Empore filter disks (3 M) was carried out as described
   previously^[273]75 and peptides were resuspended in buffer A* (0.2%
   TFA, 2% ACN) for LC–MS/MS analysis.

TAOK2 affinity purification

   Plasmids coding for truncated (amino acids 1–993) and affinity-tagged
   (C-terminal V5 tag) wild-type rat TAOK2 or mutated (R702C or D151A) rat
   TAOK2 variants, or coding for V5-tagged control baits, EGFP and PGAM5,
   were transfected (PEI) into HEK293T cells. Following induction of bait
   expression with doxycycline for 1 day, cells were left untreated or
   stimulated by transfection (PEI) of 5 µg/ml poly(I:C) for 4 h. For each
   bait and condition, quadruplicate affinity purifications were performed
   as described previously^[274]75. Briefly, cell pellets from two 15-cm
   dishes were lysed in TAP lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM
   NaCl, 1.5 mM MgCl[2], 0.2% (v/v) NP-40, 5% (v/v) glycerol, cOmplete
   protease inhibitor cocktail (Roche), 0.5% (v/v) 750 U/μl Sm DNase) and
   sonicated (5 min, 4 °C, 30 s on, 30 s off, low settings; Bioruptor,
   Diagenode). Following normalization of protein concentrations, cleared
   lysates were incubated with 20 µl anti-V5-agarose affinity gel
   (Sigma-Aldrich, A7345) with constant agitation for 3 h at 4 °C.
   Nonspecifically bound proteins were removed by four subsequent washes
   with lysis buffer followed by three detergent-removal steps with
   washing buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1.5 mM MgCl[2], 5%
   (v/v) glycerol). Enriched proteins were denatured by the addition of
   SDC lysis buffer (4% SDC, 100 mM Tris-HCl, pH 8.5), followed by
   reduction and alkylation for 5 min at 45 °C with TCEP (10 mM) and CAA
   (40 mM) and digested overnight at 37 °C using trypsin (1:100 w/w,
   enzyme/protein, Sigma-Aldrich) and LysC (1:100 w/w, enzyme/protein,
   Wako). Peptides were desalted and concentrated using SDB-RPS StageTips
   (Empore). In brief, samples were diluted with 1% TFA in isopropanol to
   a final volume of 200 μl and loaded onto StageTips, subsequently washed
   with 200 μl of 1% TFA in isopropanol and 200 μl 0.2% TFA/2% ACN.
   Peptides were eluted with 75 μl of 1.25% ammonium hydroxide (NH4OH) in
   80% ACN and dried using a SpeedVac centrifuge (Eppendorf, Concentrator
   Plus). Peptides were resuspended in buffer A* (0.2% TFA, 2% ACN) before
   LC–MS/MS analysis.

   A fraction of the cell pellets used for affinity purification was
   further prepared for full proteome analysis. To this end, cell pellets
   were lysed in SDC lysis buffer (4% SDC in 100 mM Tris-HCl, pH 8.5) for
   5 min at 9 °C and sonicated (15 min, 4 °C, 30 s on, 30 s off, high
   settings; Bioruptor, Diagenode). Following normalization of protein
   concentrations, proteins were reduced and alkylated for 5 min at 45 °C
   with TCEP (10 mM) and CAA (40 mM), and digested overnight at 37 °C
   using trypsin (1:100 w/w, enzyme/protein, Sigma-Aldrich) and LysC
   (1:100 w/w, enzyme/protein, Wako). Peptides were purified with SDB-RPS
   StageTips as described for TAOK2-AP-MS samples.

Full proteome analysis of SFV-infected TAOK2 KO THP-1 cells

   For full proteome (FP) analysis, THP-1 cells with KO of TAOK1, -2, -3,
   STAT1, or NEG4 (control) were mock-treated or infected with SFV. Cell
   pellets of quadruplicates were lysed (6 M GdmCl, 10 mM TCEP, 40 mM CAA,
   100 mM Tris-HCl pH 8), boiled at 99 °C for 10 min and sonicated
   (15 min, 4 °C, 30 s on, 30 s off, high setting; Bioruptor Plus).
   Protein concentrations of cleared lysates were normalized to 50 µg and
   proteins were pre-digested with 1 μg LysC (37 °C, 3 h) followed by a
   1:10 dilution (100 mM Tris-HCl pH 8) and overnight digestion with 1 μg
   trypsin at 30 °C. Peptide purification based on C18 Empore filter disks
   (3 M) was carried out as described previously^[275]75 and peptides were
   resuspended in buffer A* (0.2% TFA, 2% ACN) for LC–MS/MS analysis.

LC–MS/MS measurements

   Purified peptides from nucleic acid affinity purifications (NA-AP),
   TAOK2 affinity purifications (TAOK2-AP), and full proteome (FP) samples
   from TAOK2-AP and TAOK2 KO FP experiments were analyzed by mass
   spectrometry as described previously^[276]112,[277]113.

   Briefly, peptides from NA-AP samples were loaded on a C18
   reversed-phase column (15–20 cm Reprosil-Pur 120 C18-AQ, 1.8 µM and
   200 mm × 0.075 mm or 3 µM and 150 mm × 0.075 mm; Dr. Maisch) and
   separated using an EASY-nLC 1200 system (Thermo Fisher Scientific) with
   a 5 to 30% acetonitrile gradient in 0.5% acetic acid at a flow rate of
   250 nl/min over a period of 95 min. The nanoLC system was directly
   coupled to the electrospray ion source of an LTQ-Orbitrap XL mass
   spectrometer (Thermo Fisher Scientific) operated in a data-dependent
   mode with a full scan at a resolution of 60,000 with concomitant
   isolation and fragmentation of the ten most abundant ions in the linear
   ion trap.

   Peptides from FP and TAOK2-AP samples were loaded on a C18
   reversed-phase column (50 cm, 60 °C; 75 μm inner diameter; packed
   in-house with ReproSil-Pur C18-AQ 1.9 μm silica beads; Dr. Maisch) and
   separated using an EASY-nLC 1200 system (Thermo Fisher Scientific) with
   a 5 to 30% acetonitrile gradient in 0.1% formic acid at a flow rate of
   300 nl/min over a period of 120 min. Eluting peptides were directly
   analyzed on a Q-Exactive HF mass spectrometer via a nano-electrospray
   source (Thermo Fisher Scientific). The data-dependent acquisition
   included repeating cycles of one MS1 full scan (300–1650 m/z,
   resolution (R) of 60,000 at m/z 200) at an automatic gain control (AGC)
   target of 3 × 10^6, followed by 15 MS2 scans of the highest abundant
   isolated and higher-energy collisional dissociation (HCD) fragmented
   peptide precursors (R of 15,000 at m/z 200). For MS2 scans, the
   collection of isolated peptide precursors was limited by an AGC target
   of 1 × 10^5 and a maximum injection time of 25 ms. Isolation and
   fragmentation of the same peptide precursor was eliminated by dynamic
   exclusion for 20 s. The isolation window of the quadrupole was set to
   1.4 m/z and HCD was set to normalized collision energy (NCE) of 27%.
   All data were acquired in profile mode using positive polarity.

Bioinformatic analysis of the MS data

   RAW files of NA-AP, FP, and TAOK2-AP datasets were processed with
   MaxQuant (NA-AP: version 1.5.0.0/ FP + TAOK2-AP:version
   1.6.14.0)^[278]114 using the standard settings, label-free quantitation
   (LFQ), and match between runs enabled. Spectra were searched against
   forward and reverse sequences of the reviewed human proteome including
   isoforms (Uniprot KB) as well as SFV (FP) or EGFP (TAOK2-AP) protein
   sequences by the built-in Andromeda search engine. The MaxQuant output
   was further analyzed using Perseus (NA-AP: version 1.5.2.1, FP: version
   1.6.13.0, TAOK2-AP:version 1.6.15.0), R (version 4.1.0), and R Studio
   (version 1.4.1717)^[279]115. Detected protein groups within the protein
   groups output table identified as known contaminants, reverse sequence
   matches, only identified by site or quantified in less than three out
   of four replicates in at least one condition were excluded. LFQ values
   were log[2]-transformed and missing values were replaced by sampling
   values from a normal distribution calculated from the measured data
   (width = 0.3 s.d., downshift = −1.8 × s.d.).

   To identify enriched proteins in the NA-AP dataset, the intensity
   values in MS runs of NA baits were compared against the controls using
   a two-sided Welch’s t-test (S0 = 1; min. 2 valid values in at least one
   group) with a permutation-based FDR of 0.05 (for the poly(I:C)
   enrichment in fly an FDR of 0.001 was used). Candidate clustering is
   based on Euclidian distance and Ward as agglomeration method.

   In the FP dataset, differentially expressed protein groups between
   control (NEG4) and TAOK1, −2, −3, or STAT1 KO THP-1 cells for each
   treatment were identified via two-sided Student’s t-test (S0 = 0.1;
   permutation-based FDR <0.05, 250 randomizations; min. 3 valid values in
   at least one group).

   In the case of the TAOK2-AP dataset, unnormalized LFQ intensities were
   first normalized by subtraction of the sample-specific median intensity
   from each protein group intensity and both control baits, EGFP and
   PGAM5, were combined into one control group for statistical analyses.
   TAOK2 interacting proteins were identified by comparing each TAOK2
   variant against the control group, separately for mock and poly(I:C)
   stimulated conditions, using a two-sided Student’s t-test
   (permutation-based FDR <0.05, 250 randomizations). Significantly
   enriched proteins were only considered as TAOK2 interactors if they
   showed a log[2] fold change enrichment of ≥1.5. STRING enrichment of
   wild-type TAOK2 interacting proteins in mock and poly(I:C) stimulated
   cells was performed in Cytoscape (version 3.8.2) using the stringApp
   (version 1.6.0) in combination with a confidence cutoff of 0.2 for
   considering functional connections and an MCL inflation parameter of 4
   for clustering.

   Protein superfamily domain annotations were identified using the CDD
   batch search^[280]116. IAV-regulating proteins were described, all
   proteins confirmed in one or more screens were considered^[281]41. For
   overlaps to NA-interaction data, candidates that were identified in at
   least one screen were considered. Overlaps with proteins changing RNA
   interaction in SINV infected cells were obtained from Table [282]S1 “18
   hpi quantitative” in Garcia-Moreno et al.^[283]17. Significant
   enrichment was calculated via Fisher exact test (Benjamini–Hochberg
   adjusted FDR <0.05). A list of known NA binders was taken from Binns et
   al.^[284]117 and compared to the identified proteins to determine the
   percentage of known NA binders. For AP EnrichmentMap^[285]118 (version
   2018.12) was used to annotate the human proteins with Gene Ontology
   (GO) terms. To identify the terms that are specifically enriched among
   the protein binders of specific NA bait or shared by multiple NA baits,
   the OptEnrichedSetCover.jl Julia package was used
   ([286]https://github.com/alyst/OptEnrichedSetCover.jl). FP annotation
   with Gene Ontology terms corresponding to biological processes (GOBP),
   molecular functions (GOMF), and cellular compartments (GOCC) was
   performed within Perseus (downloaded from
   [287]http://annotations.perseus-framework.org, 06.2019). Testing for
   the enrichment of annotations within significantly changing protein
   groups was done using Fisher exact test with the Benjamini–Hochberg
   adjusted FDR cutoff set to 0.05. Orthologues mapping was performed
   using DRSC Integrative Ortholog Prediction Tool^[288]51, excluding the
   orthologous with a DIOPT score less than 2 (low score). Identified
   human orthologues were filtered against an experimentally determined
   THP-1 proteome, so as to not include orthologues of proteins that could
   not be experimentally identified in THP-1 cells in the interspecies
   comparison. Upstream promoter analysis was performed using
   iRegulon^[289]68.

Selection of Candidates

   After the statistical analysis of the data, a score was calculated for
   each bait-control comparison (1):
   [MATH: <msup><mrow><mrow><mo>(</mo><mrow><mi
   mathvariant="normal">foldchange</mi><mo>⋅</mo><mo>−</mo><mspace
   width="0.25em"></mspace><mi mathvariant="normal">log</mi><mspace
   width="0.25em"></mspace><mrow><mo>(</mo><mrow><mi
   mathvariant="normal">pvalue</mi></mrow><mo>)</mo></mrow></mrow><mo>)</m
   o></mrow></mrow><mrow><mn>5</mn></mrow></msup><mo>⋅</mo><mi
   mathvariant="normal">proteome</mi><mspace
   width="0.25em"></mspace><msup><mrow><mi
   mathvariant="normal">abundance</mi></mrow><mrow><mn>0.05</mn></mrow></m
   sup><mo>⋅</mo><mi mathvariant="normal">number</mi><mspace
   width="0.25em"></mspace><mi mathvariant="normal">of</mi><mspace
   width="0.25em"></mspace><mi mathvariant="normal">affinity</mi><mspace
   width="0.25em"></mspace><mi
   mathvariant="normal">purifications</mi><mspace
   width="0.25em"></mspace><mi mathvariant="normal">with</mi><mspace
   width="0.25em"></mspace><mi mathvariant="normal">valid</mi><mspace
   width="0.25em"></mspace><msup><mrow><mi
   mathvariant="normal">values</mi></mrow><mrow><mn>0.01</mn></mrow></msup
   ><mo>.</mo> :MATH]
   1

   For each bait, the top 200 protein candidates of humans were compared
   to the 200 best mouse ones. Final candidates were selected factoring in
   the regulation of potential candidates by type-I or type-II interferon
   (fold change >2) (interferome.org) and excluding known nucleic acid
   sensors and proteins involved in transcription. For the drosophila
   candidate list, the 10% of interactors with the highest score were
   compared to the final human/mouse candidate list and fly proteins with
   orthologues were selected. The remaining proteins of the fly candidate
   list were selected based on the knowledge available from literature and
   predicted GO terms.

CRISPR/Cas9 KO screen in human cells

   sgRNA sequences targeting 90 candidate genes and the positive control
   STAT1 were selected using the GPP sgRNA designer^[290]119
   (Supplementary Data [291]10). The sgRNA sequences (three per gene),
   including 12 negative controls previously tested in human
   cells^[292]120, were cloned into lentiCRISPRv2 vector (Addgene #
   52961), carrying the Streptococcus pyogenes Cas9 enzyme and puromycin
   resistance. Lentiviral particles were generated by transient
   transfection of sub-confluent HEK293T cells (ATCC, grown in DMEM
   supplemented with 10% FCS and 1% penicillin/streptomycin (Gibco) with
   the lentiCRISPRv2, psPAX2 (Addgene #12260), and pMD2.G (Addgene #12259)
   vectors, using PolyFect (Qiagen). The media was exchanged to RPMI
   supplemented with 10% FCS and 1% penicillin/streptomycin (Gibco) 24 h
   post-transfection. Viral supernatants were collected 72 h
   post-transfection, filtered, and stored at –80 °C until further use.
   THP-1 cells were seeded at 5E5 cells/mL in 400 and 600 µL of lentivirus
   (200 µL per sgRN9) were added. After overnight incubating the medium
   was replaced with 1 µg/mL puromycin (Sigma P8833) containing medium.
   The cells were maintained and scaled up in 1 µg/mL puromycin-containing
   medium for 16 days. For the viral screening, the cells were seeded at
   0.5E5 cells/well in a 96-well plate, each cell line was seeded in
   technical triplicates. Half of the THP-1 cells were differentiated with
   PMA upon seeding overnight before stimulation. One day after seeding,
   the cells were infected with one of four viruses; HSV-1-Firefly Luc
   (MOI 0.2), Influenza A SC35M NS1_2A_Gaussia_2A_NEP (MOI 0.1),
   SFV6-2SG-Gaussia-Luc (MOI 0.1), and VSV-Firefly Luc (MOI 0.1).
   Seventeen hours after infection cell viability, as well as the
   accumulated luciferase signal, were measured. To determine cell
   viability, 50 µg/mL of resazurin (Sigma R7017) were added to each well
   and incubated at 37 °C for 30 min, after which the fluorescence
   (535/590 nm) was measured using an Infinite 200 PRO series microplate
   reader (Tecan). Gaussia luciferase levels were determined; 20 µL of
   cell supernatant was mixed with 20 µL of Gaussia Luciferase buffer
   (20 mM MOPS, 75 mM KBr, 1 mM EDTA, 5 mM MgCl2, pH adjusted to 7.8 with
   300:1 of a coelenterazine (Carl Roth #4094.3) solution 3 mM in
   acidified methanol) and incubated at RT in the dark for 5 min, after
   which the luminescence was measured using an Infinite 200 PRO series
   microplate reader (Tecan). The levels of firefly luciferase were
   measured by first pelleting cells (800 rpm for 5 min), followed by
   resuspension in 50 µl 1x Passive lysis buffer (Promega #E1941) and a
   freeze-thaw cycle to break the cell membrane. About 20 µl of cell
   lysate was mixed with 20 µl of firefly substrate (20 mM Tricine,
   3.74 mM MgSO4, 33.3 mM DTT, 0.1 mM EDTA, 270 µM Coenzyme A trilithium
   salt (Sigma-Aldrich #C3019), 470 µM d-Luciferin sodium salt
   (Sigma-Aldrich #L6882), 530 µM ATP disodium salt (Sigma-Aldrich
   #A7699), pH 7.8-8), and incubated at RT in the dark for 5 min, after
   which the luminescence was measured using a plate reader. Statistical
   analysis of the luminescence data was done in R (v3.3). Cell viability
   and luciferase data were fit using the random-effects generalized
   linear Bayesian model, which, in R glm notation, could be expressed as
   (2):
   [MATH:
   <mi>l</mi><mi>o</mi><msub><mrow><mi>g</mi></mrow><mrow><mn>2</mn></mrow
   ></msub><mrow><mo>(</mo><mrow><mi
   mathvariant="normal">intensity</mi></mrow><mo>)</mo></mrow><mo>~</mo><m
   n>1</mn><mo>+</mo><mi mathvariant="normal">batch</mi><mo>+</mo><mi
   mathvariant="normal">virus</mi><mo>*</mo><mi
   mathvariant="normal">gene</mi> :MATH]
   2

   The effects corresponding to the screen batch, the virus infection
   (virus), gene KO (gene), and the effect of interaction between the last
   two model factors were set to have horseshoe prior
   distribution^[293]121. The distribution of log[2](intensity) was set to
   be Laplacian for robust handling of outliers. The model was fit with
   the No-U-Turn Markov Chain Monte Carlo sampler implemented in rstan R
   package (ver. 2.15^[294]122). About 2000 iterations of the sampling
   method (1000 warmup + 1000 sampling) in eight independent MCMC chains
   were done. The model parameters samples were collected at each second
   iteration of the MCMC run. To estimate the significance of the viral
   replication change/cell viability, the reconstructed batch effect-free
   posterior distribution of luciferase intensity upon virus infection and
   gene KO (Luc[KO]) was compared with the posterior distribution of NT
   control (Luc[NT]). The significance was defined as the probability that
   the log[2] fold change of luciferase intensity is different from zero
   (3):
   [MATH: <msub><mrow><mi>P</mi></mrow><mrow><mi
   mathvariant="normal">value</mi></mrow></msub><mo>=</mo><mn>2</mn><mo>⋅<
   /mo><mspace
   width="0.25em"></mspace><mi>min</mi><mrow><mo>(</mo><mrow><mi>P</mi><mr
   ow><mo>(</mo><mrow><mi mathvariant="normal">lo</mi><msub><mrow><mi
   mathvariant="normal">g</mi></mrow><mrow><mn>2</mn></mrow></msub><mrow><
   mo>(</mo><mrow><mi>L</mi><mi>u</mi><msub><mrow><mi>c</mi></mrow><mrow><
   mi
   mathvariant="normal">KO</mi></mrow></msub><mo>/</mo><mi>L</mi><mi>u</mi
   ><msub><mrow><mi>c</mi></mrow><mrow><mi
   mathvariant="normal">NT</mi></mrow></msub></mrow><mo>)</mo></mrow><mspa
   ce width="0.25em"></mspace><mo><</mo><mspace
   width="0.25em"></mspace><mn>0</mn></mrow><mo>)</mo></mrow><mo>,</mo><mi
   >P</mi><mrow><mo>(</mo><mrow><msub><mrow><mi>log</mi></mrow><mrow><mn>2
   </mn></mrow></msub><mrow><mo>(</mo><mrow><mi>L</mi><mi>u</mi><msub><mro
   w><mi>c</mi></mrow><mrow><mi
   mathvariant="normal">KO</mi></mrow></msub><mo>/</mo><mi>L</mi><mi>u</mi
   ><msub><mrow><mi>c</mi></mrow><mrow><mi
   mathvariant="normal">NT</mi></mrow></msub></mrow><mo>)</mo></mrow><mspa
   ce width="0.25em"></mspace><mo>></mo><mspace
   width="0.25em"></mspace><mn>0</mn></mrow><mo>)</mo></mrow></mrow><mo>)<
   /mo></mrow><mo>.</mo> :MATH]
   3

   No P value correction for multiple hypothesis testing was done since
   this is handled by the choice of model parameters prior to
   distribution.

Knockdown screen in flies

   KK and GD inverted repeat transgenic fly lines from the VDRC stock
   center were used to induce the knockdown of candidate genes
   (Supplementary Data [295]10). shmCherry (BDSC #35787) and shAGO2 (BDSC
   #34799) were used as controls. Transgenic males containing shRNA and
   the inverted repeat of the target gene under the control of Gal4
   regulated upstream activating sequence (UAS) were crossed with virgin
   females [Actin-Gal4/CyO; Tubulin-Gal80^TS] at 18 °C. The F1 generation
   confirming genotype was placed at 29 °C for 5–7 days to induce the
   knockdown of candidate genes. All experiments were subsequently done at
   29 °C.

   Viral stocks were prepared in 10 mM Tris-HCl, pH 7.5. Infections were
   performed with 6–8 days old adult flies by intrathoracic injection
   (Nanoject II apparatus, Drummond Scientific) with 4.6 nL of viral
   particle solution (500 pfu/fly for DCV and FHV, 5 pfu/fly for CrPV,
   2500 pfu/fly for SINV, 10,000 pfu/fly for VSV). Injection of the same
   volume of 10 mM Tris-HCl, pH 7.5, was used as a control. Infected flies
   were frozen, three males and three females per condition, for RNA
   isolation at the indicated time points.

   Total RNA from flies was isolated using a NucleoSpin 96 kit or manually
   using Trizol Reagent RT bromoanisole solution (MRC), according to the
   manufacturer’s instructions. One microgram of total RNA was reverse
   transcribed using an iScriptTM cDNA synthesis kit (Bio-rad). About
   100 ng of cDNA was used for quantitative real-time PCR (RT-qPCR), using
   iQTM Custom SYBR Green Supermix Kit (Bio-rad) for fly samples,
   according to the manufacturer’s instructions, on a CFX384 Touch
   Real-Time PCR platform (Bio-Rad). Primers targeting viral sequences are
   listed in Goto et al. and in Supplementary Table [296]1^[297]123.

   All statistical analysis was done in R (version 3.5.0). ΔCq was
   calculated by subtracting CqVirus from CqRP49. Significance was
   calculated using lsmeans R package (version 2.30) with Dunnet’s
   adjustment for p values.

Recombinant dTao kinase activity and affinity measurements

   The recombinant full-length dTao (CG14217) was produced by the Core
   Facility of the Max Planck Institute of Biochemistry. dTao was cloned
   into pCoofy27 (Addgene #44003) for baculovirus-based expression in High
   Five cells^[298]124. Cells were lysed via douncing (1 mM AEBSF-HCl,
   2 µg/mL Aprotinin, 1 µg/mL Leupeptin, 1 µg/mL Pepstatin, 2,4 U/mL
   Benzonase, 2 mM MgCl2). Protein purification was performed using the
   coupled N-His6 tag via affinity purification (Ni Sepharose
   High-Performance GE) in His Binding Buffer (50 mM Na-P, 500 mM NaCl,
   10 mM Imidazole, 10% Glycerin, and 1 mM TCEP, pH 8) at 4 °C for 2.5 h
   and washed with His Wash Buffer (50 mM Na-P, 500 mM NaCl, 20 mM
   Imidazole, 10% Glycerin, and 1 mM TCEP, pH 8). Purified protein was
   eluted from the beads using His Elution Buffer (50 mM Na-P, 500 mM
   NaCl, 250 mM Imidazole, 10% Glycerin, and 1 mM TCEP, pH 8). The protein
   was further purified by gel filtration (HiLoad 26/60 Superdex 200 GE)
   and eluted in Storage Buffer (20 mM Tris, 200 mM NaCl, 10% Glycerin,
   0.2 mM EGTA, and 1 mM TCEP, pH 8) and concentrated (Amicon Ultra 15) at
   3700 rpm, 4 °C in 5 min steps. The production was verified using LC–MS.
   The kinase activity in the presence or absence of poly(I:C) was
   determined using the ADP-Glo™ Kinase Assay kit (Promega; V9101) and
   performed according to the manufacturer’s instructions. Briefly, dTao
   was mixed with a substrate, ATP, and poly(I:C) or additional buffer,
   and incubated. After the incubation, the remaining ATP was depleted,
   ADP was converted to ATP which was then used for a luciferase reaction.

   To determine the affinity between dTao and poly(I:C) a fluorescence
   quenching assay was used. Briefly, the fluorescence of the FITC-tagged
   poly(I:C) (2.5 µg/mL) was measured in presence of increasing
   concentrations of dTao or denatured dTao (2% SDS (Sigma) boiling at
   95 °C for 5 min). The analysis was performed using the built-software
   Affinity Analysis v2.2.4 (NanoTemper Technologies MO) for Initial
   fluorescence.

Live-cell imaging, RT-qPCR, and cytokine measurements

   THP-1 cells CRISPR/Cas9 targeted for the indicated gene were seeded at
   2.5E5 cells/mL. After overnight incubation, the cells were infected
   with the indicated fluorescent viruses and the fluorescent signal was
   followed over time. A549-IFIT1-eGFP CRISPR/Cas9 targeted for the
   indicated gene were seeded at 5E3 cells/mL. After overnight incubation
   the cells were infected with the indicated viruses, treated with IFN-α
   B/D (1000 units/mL) or transfected with poly(I:C) (2 µg/mL), 100 ng/mL
   in vitro transcribed triphosphorylated hairpin RNA (IVT4)^[299]125,
   100 ng pTO-SII-HA-MAVS expression plasmid or PBS as a control using
   METAFECTENE Pro^® (2 µg/mL, Biontex), and the fluorescent signal was
   followed over time. A549-ACE2 cells were seeded at around 50%
   confluence, incubated overnight, and pretreated for 6 h with RAF265
   (10 µM) before infection with GFP-expressing SARS-CoV-2 reporter virus
   (MOI 3). Fluorescence intensity was measured every 2–4 h using an
   Incucyte S3 fluorescence light microscopy screening platform
   (Sartorius). The fluorescence intensity of the reporter was assessed as
   integrated intensity per image normalized on cell confluence per well
   using IncuCyte S3 Software (Essen Bioscience; version 2019B Rev2).
   Two-way ANOVA with Geissser–Greenhouse correction and Sidak’s multiple
   comparisons test was performed with GraphPad Prism (version 9.1.0) to
   evaluate the significance.

   Total cellular RNA was harvested and isolated using MACHEREY-NAGEL
   NucleoSpin RNA mini kit according to manufacturer instructions. Reverse
   transcription was performed using Takara PrimeScript RT reagent kit
   with gDNA eraser according to manufacturer instructions. RT-qPCR was
   performed using primers targeting GAPDH (for: GATTCCACCCATGGCAAATTC;
   rev: AGCATCGCCCCACTTGATT), SFV (for: GCAAGAGGCAAACGAACAGA; rev:
   GGGAAAAGATGAGCAAACCA), and MX1 (for: TGGAGGCACTGTCAGGAGTT; rev:
   CCACAGCCACTCTGGTTATG). PowerUp SYBR Green (Thermo Fisher, A25778) was
   used on QuantStudio 3 Real-Time PCR system (Thermo Fisher). Ct values,
   obtained using QuantStudio Design and Analysis Software v1.4.3, were
   averaged across technical replicates and fold change values were used
   as a measure of gene expression (calculated from ΔΔCt method,
   calibrated to control or mock control for SFV and MX1, respectively).

   The ELISA and cytometric bead array were used according to the
   manufacturer’s protocol and measured using an Infinite 200 PRO series
   microplate reader (Tecan) and Bio-Plex 200 Luminex Technology,
   respectively.

Reporting Summary

   Further information on research design is available in the [300]Nature
   Research Reporting Summary linked to this article.

Supplementary information

   [301]Supplementary Information^ (7.9MB, pdf)
   [302]Peer Review File^ (671.6KB, pdf)
   [303]41467_2021_27192_MOESM3_ESM.pdf^ (89KB, pdf)

   Description of Additional Supplementary Files
   [304]Supplementary Data 1^ (11.3KB, xlsx)
   [305]Supplementary Data 2^ (1.6MB, xlsx)
   [306]Supplementary Data 3^ (2.1MB, xlsx)
   [307]Supplementary Data 4^ (2.1MB, xlsx)
   [308]Supplementary Data 5^ (1.2MB, xlsx)
   [309]Supplementary Data 6^ (508KB, xlsx)
   [310]Supplementary Data 7^ (55.7KB, xlsx)
   [311]Supplementary Data 8^ (382.2KB, xlsx)
   [312]Supplementary Data 9^ (296.3KB, xlsx)
   [313]Supplementary Data 10^ (18.8KB, xlsx)
   [314]Supplementary Data 11^ (7.4MB, xlsx)
   [315]Supplementary Data 12^ (3.1MB, xlsx)
   [316]Reporting Summary^ (2MB, pdf)

Acknowledgements