Abstract

   Background: FcγRIIB, the sole inhibitory receptor of the Fc gamma
   receptor family, plays pivotal roles in innate and adaptive immune
   responses. However, the expression and function of FcγRIIB in
   myeloid-derived suppressor cells (MDSCs) remains unknown. This study
   aimed to investigate whether and how FcγRIIB regulates the
   immunosuppressive activity of MDSCs during cancer development.

   Methods: The MC38 and B16-F10 tumor-bearing mouse models were
   established to investigate the role of FcγRIIB during tumor
   progression. FcγRIIB-deficient mice, adoptive cell transfer,
   mRNA-sequencing and flow cytometry analysis were used to assess the
   role of FcγRIIB on immunosuppressive activity and differentiation of
   MDSCs.

   Results: Here we show that FcγRIIB was upregulated in tumor-infiltrated
   MDSCs. FcγRIIB-deficient mice showed decreased accumulation of MDSCs in
   the tumor microenvironment (TME) compared with wild-type mice. FcγRIIB
   was required for the differentiation and immunosuppressive activity of
   MDSCs. Mechanistically, tumor cell-derived granulocyte-macrophage
   colony stimulating factor (GM-CSF) increased the expression of FcγRIIB
   on hematopoietic progenitor cells (HPCs) by activating specificity
   protein 1 (Sp1), subsequently FcγRIIB promoted the generation of MDSCs
   from HPCs via Stat3 signaling. Furthermore, blockade of Sp1 dampened
   MDSC differentiation and infiltration in the TME and enhanced the
   anti-tumor therapeutic efficacy of gemcitabine.

   Conclusion: These results uncover an unrecognized regulatory role of
   the FcγRIIB in abnormal differentiation of MDSCs during cancer
   development and suggest a potential therapeutic target for anti-tumor
   therapy.

   Keywords: myeloid-derived suppressor cells, Fc gamma receptor IIB,
   tumor microenvironment, granulocyte-macrophage colony stimulating
   factor, immunosuppression, anti-tumor therapy, Sp1 signaling

Introduction

   Tumor progression is accompanied by infiltration of a large number of
   immune cells in the tumor microenvironment (TME) [45]^1. The
   immunosuppressive TME plays a critical role in determining the outcome
   of tumor progression or remission [46]^2. Of the infiltrating immune
   cells in the TME, myeloid-derived suppressor cells (MDSCs) are the
   predominant population [47]^3. Studies suggest that the frequency of
   MDSC is associated with tumor stage, burden and metastasis, while a
   massive accumulation of circulating MDSCs correlates with poor
   prognosis in cancer patients [48]^4^, [49]^5. MDSCs are a heterogeneous
   group of immature hematopoietic cells that originate from multipotent
   hematopoietic progenitor cells (HPCs) and are recruited to the TME by
   tumor-secreted and host-secreted molecules, such as
   granulocyte-macrophage colony stimulating factor (GM-CSF) [50]^6. MDSCs
   are characterized by a CD11b^+Gr1^+ phenotype, and can be further
   classified into monocytic (mMDSC, CD11b^+Ly6C^highLy6G^-) and
   granulocytic (gMDSC, CD11b^+Ly6G^+Ly6C^low) subpopulations in
   tumor-bearing mice [51]^7. Both of these subpopulations can suppress
   the activity of antigen-activated CD8^+ T cells through multiple
   mechanisms. MDSCs express arginase and inducible nitric oxide synthase
   (iNOS), thus depriving arginine in the TME and suppressing the
   proliferation of T cells [52]^8. They also highly express programmed
   death-ligand 1 (PD-L1) and reactive oxygen species (ROS) to suppress
   the activation of cytotoxic T lymphocytes (CTLs) [53]^9. Additionally,
   MDSCs secrete prostaglandin E[2] (PGE[2]), calcium-binding protein
   S100A8/A9, transforming growth factor-β (TGFβ), and other cytokines to
   promote tumor growth and progression [54]^10. Moreover, mMDSCs can
   further differentiate into tumor-associated macrophages (TAMs) and
   promote the immunosuppressive function of regulatory T cells (Tregs)
   [55]^11. Therefore, identification of molecular pathways that influence
   the immunosuppressive activity of MDSCs or inhibit accumulation of
   MDSCs in the TME will provide new approaches for improving the response
   to immunotherapy.

   Receptors with the Fc region of immunoglobulins (Igs) play an essential
   role in the activation and/or inhibition of immune responses [56]^12.
   Fc gamma receptor IIB (FcγRIIB/CD32B) is the only inhibitory member of
   the Fc gamma receptor family expressed on the B cells, macrophages,
   dendritic cells (DCs), and granulocytes [57]^13. The intracellular
   domain of this receptor contains an immunoreceptor tyrosine-based
   inhibitory motif (ITIM) that recruits the inhibitory phosphatase SHIP,
   which inhibits the phosphorylation of downstream signaling molecules
   involved in the activation of monocytes, macrophages, and DCs [58]^14.
   Activation of this receptor reduces the cell proliferation and antibody
   production, and may also deliver apoptotic signals [59]^15. Moreover,
   FcγRIIB is a negative regulator of antibody production and inflammatory
   responses [60]^16. Genetic deficiency of FcγRIIB was shown to enhance
   tumor-infiltrating CD8^+ T cell responses and reduce tumor burden
   [61]^17. However, the expression and function of FcγRIIB in MDSCs have
   not yet been studied.

   Here, we aimed to investigate the role of FcγRIIB on MDSCs during
   cancer development, and explore new anti-cancer approaches by targeting
   FcγRIIB.

Results

Expression of FcγRIIB is elevated in tumor-infiltrating MDSCs

   We analyzed the expression of FcγRIIB in human colorectal cancer (CRC)
   tissues using Kurashina Colon cancer datasets in Oncomine and found
   that FcγRIIB expression was modestly increased in the CRC tissues than
   that in normal tissues (Figure [62]1A). Next, we examined FcγRIIB
   expression in tumor tissues of MC38 tumor-bearing mice. Consistent with
   results of previous reports [63]^18^, [64]^19, FcγRIIB was expressed in
   several cell types, including the B cells, dendritic cells (DCs), and
   macrophages (Figures [65]1B, 1C and S1). Of note, 10-fold increase of
   FcγRIIB was observed in tumor-infiltrating MDSCs than that in other
   myeloid-derived cells. In addition, the expression of FcγRIIB on MDSCs
   increased with tumor progression (Figure [66]1D). Further analysis
   revealed that both mMDSCs and gMDSCs expressed high levels of FcγRIIB
   in the TME, among which, mMDSCs showed higher levels of FcγRIIB than
   gMDSCs in the spleen of MC38 tumor-bearing mice (Figure [67]1E). An
   increased FcγRIIB expression was also observed in MDSCs from the
   peripheral blood from CRC patients (Figures [68]1F and [69]1G). These
   results demonstrate that FcγRIIB is elevated in tumor-infiltrating
   MDSCs during tumorigenesis.

Figure 1.

   [70]Figure 1
   [71]Open in a new tab

   Increased FcγRIIB expression on tumor-infiltrating MDSCs. (A) Gene
   expression of FCGR2B in normal colon, colon adenocarcinoma, colon
   mucinous adenocarcinoma and rectal adenocarcinoma tissues according to
   Kurashina Colon cancer in Oncomine datasets. (B) Representative
   histogram plots of the expression of FcγRIIB in T cells, B cells, DCs,
   MDSCs and macrophages from splenocytes of tumor free mice (Spl), MC38
   tumor tissues (Tumor) and splenocytes of tumor bearing mice (T-Spl),
   ISO, isotype control. (C) The expression of FcγRIIB for T cells, B
   cells, DCs, MDSCs and macrophages, as shown in (B), MFI is shown, n =
   4. (D) The expression of FcγRIIB for MDSCs (CD11b^+Gr1^+) in the
   splenocytes of 100 μL PBS injected C57BL/6 mice for 21days (Spl) or
   MC38 tumor tissues were quantified at different time points (7, 14 and
   21days) after MC38 tumor cell inoculation (n = 4). (E) FcγRIIB
   expression in gMDSCs (CD11b^+Ly6G^+Ly6C^low) and mMDSCs
   (CD11b^+Ly6C^highLy6G^-) from the MC38 tumor bearing spleens (T-spl) or
   MC38 tumor tissues were measured by FCM, n = 4. (F, G) Representative
   flow cytometry plots (E) and FcγRIIB expression (F) of MDSCs in the
   peripheral blood of patients with CRC versus healthy donors (n = 7).
   Data are expressed as means ± SD. ^*P < 0.05, ^**P < 0.01, ^***P <
   0.001, Mann-Whitney test were used for all comparisons, ns, no
   significant difference.

Deficiency of FcγRIIB impairs MDSC accumulation and tumorigenesis

   To assess the role of FcγRIIB on tumorigenesis, the MC38 cells were
   subcutaneously inoculated into wild-type (WT) and FcγRIIB^-/- (KO)
   mice. The KO mice showed slower growth of xenograft tumors and
   prolonged survival than WT mice (Figures [72]2A and S2A). The tumor
   growth was also dampened in KO mice implanted with B16F10 melanoma
   cells than in WT mice ([73]Figure S2B). Tumor-bearing mice always show
   splenomegaly at later stages of tumorigenesis [74]^20. We found that
   the spleen size in tumor-bearing KO mice was smaller than that in
   tumor-bearing WT mice, while it was comparable to that in tumor-free WT
   mice ([75]Figure S2C).

Figure 2.

   [76]Figure 2
   [77]Open in a new tab

   FcγRIIB deficiency in MDSCs inhibits tumorigenesis. (A) C57BL/6 (WT) or
   FcγRIIB^-/- (KO) mice were injected subcutaneously with 10^6 MC38
   cells. Tumor growth was monitored at indicated time points, n = 5. (B)
   WT or KO mice were sacrificed at day 14 post-xenograft of MC38 cells
   and tumors were analyzed by FCM for the frequency of CD4^+ and CD8^+ T
   cells. Shown data are representative from two independent experiments,
   n = 5 per group. (C, D) The frequency of IFN-γ-producing (C) and
   GzmB-producing (D) CD8^+ T cells in the MC38 tumor from WT and
   FcγRIIB-KO mice were determined by FCM. (E) The frequency of
   tumor-infiltrating MDSCs in WT or KO tumor was assessed 14 days after
   MC38 tumor inoculation. (F) The expression of Gr-1 (green) in MC38
   tumor tissue sections from WT or KO mice was detected by
   immunofluorescence. Scale bars: 50 μm. (G) gMDSCs and mMDSCs frequency
   in CD11b^+ cells from WT or KO tumor tissues were analyzed by FCM. (H,
   I) PD-L1 (H) and Arg1 (I) expression in gMDSCs and mMDSCs from WT or KO
   tumor tissues were analyzed by FCM; n = 4. (J-L), Irradiated WT mice
   (CD45.1) were i.v. injected with WT (CD45.2) or FcγRIIb^-/- (CD45.2) BM
   Cells for BM reconstitution assay. Six weeks after BM chimaera
   reconstitution, mice were injected subcutaneously with 1 × 10^6 MC38
   cells. Tumor size was monitored over time (J), n = 5; The frequency of
   tumor-infiltrating MDSCs, n = 5 (K), CD8^+ T cells and IFN-γ-producing
   CD8^+ T cells, n = 5 (L) in tumor from BM chimeric mice was assessed.
   Data are expressed as means ± SD. ^*P < 0.05, ^**P < 0.01, ^***P <
   0.001, by Mann-Whitney test.

   CD8^+ T cells are pivotal for controlling tumor growth [78]^21. We
   found that the percentages of tumor-infiltrating CD8^+ T cells were
   increased in KO mice than that in WT mice (Figures [79]2B and S2D-F).
   Moreover, the proportions of interferon γ (IFNγ) and granzyme B
   (GzmB)-producing CD8^+ T cells were significantly increased in KO mice
   than that in WT mice, suggesting that compared with WT mice, the
   anti-tumor immunity was enhanced in the FcγRIIB deficient mice (Figures
   [80]2C and [81]2D).

   In the TME, immunosuppressive cells, including MDSCs, tumor-associated
   macrophages (TAMs), and Tregs suppress the activity of CD8^+ T-cells
   [82]^22. We determined the infiltration of these immunosuppressive
   cells into the TME, and found that MDSC accumulation was reduced in the
   tumor and spleen of MC38 tumor-bearing FcγRIIB-KO mice than in that of
   tumor-bearing WT mice (Figures [83]2E, 2F, and S2D-H), whereas there
   was no significant difference in the levels of Treg cells, B cells, and
   DCs ([84]Figures S2D-E). Similarly, decreased MDSC accumulation were
   also observed in B16F10 tumor-bearing FcγRIIB-KO mice ([85]Figure S2I).
   Interestingly, the percentages of TAMs were higher in KO tumors than in
   WT control. Compared with WT TAMs, the FcγRIIB-KO TAMs exhibited
   increased M1 markers CD86 and MHC II, whereas the expression of CD80
   showed no significant difference ([86]Figure S2J). Additionally, the
   proportion of mMDSC subpopulations remained unchanged, but that of
   gMDSCs decreased in FcγRIIB deficient mice (Figures [87]2G and S2D),
   indicating that the major decreased proportion of MDSCs in KO mice was
   gMDSCs. The mMDSCs and gMDSCs from FcγRIIB-KO mice expressed decreased
   PD-L1, and mMDSCs expressed slightly decreased arginase-1 (Arg-1)
   (Figures [88]2H, 2I and S2K).

   To investigate whether the reduced tumor burden in KO mice was due to
   the loss of FcγRIIB in MDSCs, we reconstituted irradiated mice with
   bone marrow (BM) cells isolated from WT or FcγRIIB KO littermates
   ([89]Figure S2L). We found that KO→WT chimeric mice exhibited reduced
   tumor growth when compared with WT→WT chimeric mice (Figure [90]2J).
   Interestingly, significantly fewer MDSCs, while abundant IFNγ^+CD8^+ T
   cells, were found in the tumor tissues from KO→WT BM chimeric mice than
   WT→WT BM chimeric mice (Figures [91]2K and [92]2L). These data
   demonstrate that FcγRIIB deficiency in MDSCs inhibits tumor development
   by reducing accumulation of gMDSC in the TME.

FcγRIIB-dependent immunosuppressive activity of MDSCs

   We next wondered whether FcγRIIB regulated the immunosuppressive
   activity of MDSCs. The levels of iNOS and Arg-1 showed no significant
   change in MDSCs from WT and FcγRIIB-KO tumor-bearing mice (Figure
   [93]3A). However, the expression level of PD-L1 was decreased in MDSCs
   from FcγRIIB-KO mice than those from WT mice (Figure [94]3B). Excessive
   ROS production is another well-known mechanism for MDSC-mediated
   immunosuppression [95]^8. We found that intracellular ROS level was
   significantly decreased in KO MDSCs than that in WT MDSCs (Figure
   [96]3C). Additionally, the activation of CD8^+ T cells was
   significantly augmented in FcγRIIB-KO than in WT mice (Figures [97]3D
   and [98]3E). Moreover, KO MDSCs also increased the proliferation of
   CD8^+ T cells than WT MDSCs (Figure [99]3F). These results indicate
   that FcγRIIB promotes the immunosuppressive activity of MDSCs that
   contributes to tumor immunoescape.

Figure 3.

   [100]Figure 3
   [101]Open in a new tab

   FcγRIIB deficiency suppresses the immunosuppressive activity and
   differentiation of MDSCs. (A) iNOS and Arg1 expression in WT and KO
   MDSCs from MC38 tumors were assessed using FCM; n = 5. (B, C) PD-L1 (B)
   and DCF-DA (C) expression in WT and KO MDSCs; n = 5. (D-F) Isolated
   MDSCs from MC38 tumors of WT and KO mice were cocultured with
   CFSE-labeled CD8^+ T lymphocytes isolated from WT mice (1:2) for 3
   days, the production of IFN-γ (D), and GzmB (E) in CD8^+ T cells,
   anti-CD3 and anti-CD28 induced proliferation (F) were measured by FCM;
   n = 4. Data are expressed as means ± SD. ^*P < 0.05, ^**P < 0.01, ns,
   no significant difference, by Mann-Whitney test.

FcγRIIB is required for gMDSC differentiation from HPCs

   As FcγRIIB-deficient mice showed decreased numbers of
   tumor-infiltrating gMDSCs, the roles of FcγRIIB on the proliferation,
   apoptosis, or chemotaxis in MDSCs were sought. However, no significant
   difference in the proliferation and apoptosis of MDSCs was observed
   between WT and KO mice (Figures [102]4A and [103]4B). Next, we analyzed
   MDSC chemotaxis-related genes, including Cxcl1, Cxcl2, Cxcl5, and
   Cxcl12 in tumor tissues. The data indicated no difference in levels of
   these genes between WT and KO mice, suggesting that decreased numbers
   of MDSCs in the tumors may not be due to decreased chemotaxis (Figure
   [104]4C).

Figure 4.

   [105]Figure 4
   [106]Open in a new tab

   FcγRIIB deficiency impairs the differentiation of gMDSCs from HPCs in
   the tumor-bearing mice. (A) The percentage of proliferating (Ki67^+)
   MDSCs in WT and KO tumor tissues were analyzed with flow cytometry
   after Ki67 staining, n = 5. (B) Representative staining and frequencies
   of AnnexinV^+7AAD^+ cells in MDSCs from WT and KO tumor tissues were
   assessed by FCM. (C) The gene expression of MDSC-related chemokines
   within whole tumor tissues from WT and KO mice were detected by qPCR; n
   = 4. Data are expressed as means ± SD. (D) WT and KO BMs were treated
   with GM-CSF/IL-6 (20ng/mL) to induce MDSCs differentiation, MDSCs ratio
   and numbers were analyzed after 72 hrs. (E) Gating strategy for
   granulocyte/macrophage progenitors (GMP;
   Lin^-Sca-1^-C-kit^+CD16/32^+CD34^+), common myeloid progenitors (CMP;
   Lin^-Sca-1^-C-kit^+CD16/32^intCD34^+), megakaryocyte/erythrocyte
   progenitors (MEP; Lin^-Sca-1^-C-kit^-CD16/32^-CD34^-), and percentages
   of these HPCs subpopulations rates in BMs from WT and KO tumor bearing
   mice were detected, n = 5. (F) Representative photograph of femurs
   dissected from WT and KO tumor-free or MC38 tumor-bearing mice on day
   21 after tumor cells implantation. Data are expressed as means ± SD.
   ^*P < 0.05, ^**P < 0.01, ^***P < 0.001, ns, no significant difference,
   by Mann-Whitney test.

   MDSCs are differentiated from HPCs and subsequent
   granulocyte/macrophage progenitors (GMP) by induction of GM-CSF
   [107]^1^, [108]^23. We treated BM cells with GM-CSF and IL-6 for 72 h,
   and found that GM-CSF treatment induced the expansion of MDSCs (Figure
   [109]4D). Moreover, FcγRIIB-KO BM cells yielded reduced numbers of
   MDSCs than WT, suggesting that FcγRIIB may contribute to the generation
   of MDSCs. Consistently, KO BM cells had decreased proportions of GMPs,
   but increased megakaryocyte/erythrocyte progenitors (MEP) within the
   HPC population than WT BM (Figure [110]4E). Furthermore, the bones from
   tumor-bearing WT mice were paler than those from tumor-bearing KO mice
   (Figure [111]4F), suggesting that erythropoiesis was dampened in WT
   tumor-bearing mice. The GMP subpopulation was also decreased in HPCs
   from KO naive mice than that from WT mice, indicating an intrinsic role
   of FcγRIIB in the differentiation of BM progenitors into GMP.
   Additionally, the GMP subpopulation was increased in tumor-bearing WT
   mice, while the expansion of GMPs was decreased in KO HPCs
   ([112]Figures S3A and S3B).

   As a member of Fc receptor family, immunoglobulins, pentraxins such as
   Serum Amyloid protein (SAP) and C Reactive Protein (CRP) can bind to
   FcγRIIB [113]^24^, [114]^25. To determine whether the differentiation
   of HPCs to MDSCs induced by FcγRIIB was functionally due to
   immunoglobulins, SAP or CRP, WT and FcγRIIB KO BM cells were stimulated
   with GM-CSF and IL-6 for 72h in the presence or absence of IgG, SAP or
   CRP. We found that IgG, SAP or CRP administration had no impact on
   expansion of MDSC populations ([115]Figures S3C and S3D), indicating
   that IgG, SAP and CRP are not required for FcγRIIB-mediated
   differentiation of HPCs. The immunosuppressive cytokine, soluble
   fibrinogen-like protein 2 (sFgl2), is also a ligand of FcγRIIB, and
   possesses immune regulatory functions via the FcγRIIB pathway [116]^26.
   However, mice deficiency of Fgl2 had no effect on the composition of
   GMPs in HPCs ([117]Figure S3E), suggesting that FcγRIIB-mediated HPC
   differentiation independent of Fgl2. Taken together, these results
   indicate that FcγRIIB is required for the differentiation of HPCs into
   GMPs, which increases the levels of tumor-infiltrating gMDSCs.

Stat3 is involved in FcγRIIB-mediated differentiation of HPCs into gMDSCs

   To elucidate the molecular mechanisms underlying FcγRIIB
   deficiency-mediated differentiation of HPCs, we performed RNA
   sequencing (RNA-seq) in HPCs from WT and FcγRIIB-KO tumor-bearing mice.
   A total of 1,786 genes were differentially expressed between WT and KO
   HPCs (Figure [118]5A). Subsequent analysis of these genes identified
   enrichment in cell activation and immune response pathways (Figure
   [119]5B). A number of transcription factors that control
   differentiation of common myeloid progenitors (CMPs) to GMPs were also
   assessed between the WT and KO groups (Figure [120]5C). JAK/STAT
   pathways have critical roles in MDSC differentiation and function
   [121]^27. The analysis showed that the expression of Stat1, Sat2, Stat3
   and Stat5b were significantly lower in FcγRIIB-deficient HPCs than that
   in WT HPCs (Figures [122]5D and [123]5E). Among these Stats, Stat3 is
   one of the most well-known protein that associated with MDSC
   differentiation and immunosuppressive functions. Stat3-mediated
   upregulation of S100A8/9 promotes accumulation of MDSCs in cancer
   [124]^28. Consistently, the expressions of S100A8 and S100A9 were lower
   in KO HPCs and MDSCs than in WT (Figures [125]5D-F), indicating that
   FcγRIIB activates Stat3 signaling. Furthermore, blocking Stat3
   signaling inhibited GM-CSF-induced expansion of MDSCs, reduced
   expression of ROS in MDSCs, and enhanced the activation and
   proliferation of CD8^+ T cells (Figures [126]5G-K). In contrast,
   IL-6-upregulated PD-L1 and ROS were remarkably abrogated by the absence
   of FcγRIIB ([127]Figures S4A and S4B). Moreover, gene set enrichment
   analysis (GSEA) also revealed that FcγRIIB-KO HPCs, but not WT HPCs,
   were positively enriched in HALLMARK gene sets for erythrocyte
   development, erythrocyte differentiation, and erythrocyte homeostasis
   signaling pathways, indicating that deficiency of FcγRIIB facilitates
   differentiation of HPCs to megakaryocyte/erythrocyte-restricted
   progenitors (MEPs) but not GMPs ([128]Figure S4C). Although other Stats
   may also participate in the MDSC differentiation, these results suggest
   that deficiency of FcγRIIB reduces the differentiation of HPCs into
   gMDSCs, at least partially through the Stat3 signaling.

Figure 5.

   [129]Figure 5
   [130]Open in a new tab

   FcγRIIB promotes gMDSCs generation from HPCs via Stat3 signaling. (A)
   Volcano plots of differentially expressed genes in HPCs from WT or
   FcγRIIB KO mice at 14 days post-grafting of MC38 cells (adjusted P ≤
   0.01 and fold change (FC) ≥ 2), n = 4. (B) Signaling pathway enrichment
   analysis of differentially expressed genes. (C) Heatmap of
   differentially expressed genes that function as transcription factors
   involved in differentiation of HPCs into GMPs, n = 4. (D) Heatmap of
   differentially expressed genes in Jak-Stat signaling from WT or FcγRIIB
   KO HPCs, n = 4. (E, F) WT or KO Mice were sacrificed at day 14
   post-grafting, and tumor-infiltrating MDSCs were assessed for Stat3 (E)
   and S100A8 (F) expression; n =5. (G) WT mice BMs were treated with Veh
   (PBS), GM-CSF (20ng/mL) for 48 hrs, in the presence or absence of
   STAT3-IN-1 (GM-Stat3i, 1μM), and MDSCs proportion were analyzed. (H, I)
   Isolated Gr-1^+ cells from BM were treated with GM-CSF (20ng/mL) for 48
   hrs, in the presence or absence of STAT3-IN-1 (GM-Stat3i, 1μM), DCF-DA
   (H) and PD-L1 (I) expression were assessed using FCM; n = 4. (J, K) BM
   derived MDSCs were treated with STAT3-IN-1 (GM-Stat3i, 1μM) for 48 hrs,
   and then cocultured with CFSE-labeled CD8^+ T lymphocytes isolated from
   WT mice (1:2) for 3 days, the production of IFN-γ in CD8^+ T cells (J,
   n = 4), anti-CD3 and anti-CD28 induced proliferation (K, n = 4) were
   measured by FCM; n = 4. Data are expressed as means ± SD. ^**P <0.01,
   by Mann-Whitney test.

Tumor cell-derived GM-CSF induces expression of FcγRIIB during MDSC
differentiation via the Sp1 signaling

   We next investigated the involvement of FcγRIIB in the differentiation
   of HPCs. We found that the expression of FcγRIIB was significantly
   elevated in MDSCs than that in HPCs (Figure [131]6A), suggesting that
   FcγRIIB was upregulated during differentiation. Further, stimulation of
   BM cells with supernatants from MC38 cancer cells led to significantly
   increased proportion of MDSCs (Figure [132]6B), along with increased
   expression of FcγRIIB in MDSCs (Figure [133]6C).

Figure 6.

   [134]Figure 6
   [135]Open in a new tab

   GM-CSF induces FcγRIIB expression on MDSCs via Sp1 signaling. (A)
   FcγRIIB expression on HPCs and tumor-infiltrating MDSCs were analyzed,
   representative histogram plots were shown. (B, C) WT and KO BM cells
   were treated with 10% tumor supernatants (from MC38 cells) for 48 hrs,
   the percentage of CD11b^+Gr-1^+ cells in BM cells (B), FcγRIIB
   expression on MDSCs (C) was determined. (D) WT mice BM cells were
   treated with PBS (Control) or GM-CSF (20 nM) for 48 hrs, the expression
   of FcγRIIB were determined with flow cytometry. (E) GM-CSF protein
   levels in supernatants of MC38 tumor were measured using ELISA, n =5.
   (F) GM-CSF protein levels in serum of tumor-free or MC38 tumor-bearing
   WT and FcγRIIb^-/- mice were measured using ELISA, n = 4 each group.
   (G) In silico analysis predicted two Sp1 binding site in the promoter
   of Fcgr2b, TSS; transcription start site. (H) ChIP assay analyzed
   recruitment of Sp1 to Fcgr2b gene locus in WT MDSCs. The prepared
   chromatin from MDSCs was immunoprecipitated with an anti-Sp1 antibody
   or control IgG, and pulled-down DNA was subjected to qPCR using the
   specific primers designed for Sp1 binding region. (I) Luciferase report
   assay of Fcgr2b promoter containing WT or mutant Sp1 binding site in
   Sp1 overexpression HPCs. (J) Sp1 expressions in CD11b^+Gr-1^+ cells
   from BM and paired tumor were measured by FCM, n = 5. (K) Sp1
   expression in WT and KO MDSCs were measured by FCM, n = 4. (L, M)
   CD11b^+Gr-1^+ cells from BM were treated with 10% tumor supernatants or
   GM-CSF (20 nM) for 48 h, the expression of Sp1 was determined by
   western blot (L) and FCM (M), n = 5. (N) CD11b^+Gr-1^+ cells from BM
   were transfected with control (sh-NC) or virus expressing shRNA against
   Sp1 (sh-Sp1), in the presence or absence of 20 nM GM-CSF for 48 hrs,
   FcγRIIB expression on MDSCs were analyzed. (O, P) BM cells were treated
   with GM-CSF for 48 hrs, in the presence or absence of 1 μL PBS (Con) or
   Mithramycin A (Mith, 20 nM), FcγRIIB expression on MDSCs (O) and the
   percentages of MDSCs (P) in BM cells were analyzed by FCM. Data are
   expressed as means ± SD. ^**P <0.01, by Mann-Whitney test (A to F, I, K
   to P) or Wilcoxon matched-pairs signed rank test (J).

   GM-CSF is an essential cytokine for expansion of MDSCs and can be
   secreted by tumors or tumor-infiltrating immune cells [136]^29.
   Treatment with GM-CSF induced expression of FcγRIIB on HPCs (Figure
   [137]6D). The supernatants from MC38 cancer cells also exhibited
   increased level of GM-CSF (Figure [138]6E) suggesting that GM-CSF may
   be responsible for upregulation of FcγRIIB and generation of MDSCs.
   Consistently, tumors bearing mice exhibited increased serum and BM
   concentrations of GM-CSF with tumor progression (Figures [139]6F, S5A,
   and S5B), suggesting that tumor cell-derived GM-CSF induces FcγRIIB
   expression to contribute to MDSC differentiation.

   To elucidate how GM-CSF regulated FcγRIIB, we analyzed the potential
   transcription factors that bind to the promoter of Fcgr2b using the
   online tool ConTra V3 [140]^30. The in silico analysis predicted two
   binding sites for Sp1 within the Fcgr2b promoter (Figure [141]6G). Sp1
   is a zinc-finger transcription factor that binds to GC-rich motifs to
   regulate the expression of genes involved in proliferation, apoptosis,
   differentiation, and immune responses [142]^31. The ChIP-qPCR results
   showed that the first DNA fragment containing the Sp1 response element
   could be amplified from the Sp1-immunoprecipitated samples, suggesting
   that this GC-rich motif may be critical for interaction with Sp1
   (Figure [143]6H). Luciferase report assay data showed that the reporter
   activity of Fcgr2b was activated by Sp1 over-expression, whereas
   mutation of predicted Sp1 binding site attenuated the ability of Sp1 to
   activate Fcgr2b promoter activity (Figure [144]6I). Moreover,
   expression of Sp1 was upregulated in tumor-infiltrating MDSCs and was
   decreased in FcγRIIB KO MDSCs (Figures [145]6J and [146]6K). The tumor
   supernatants and treatment with GM-CSF also significantly upregulated
   the expression of Sp1 (Figures [147]6L and 6M). Knockdown (KD) of Sp1
   or mithramycin A (Mith; Sp1 inhibitor) treatment decreased the
   expression of FcγRIIB in mouse MDSCs (Figures [148]6N and 6O) and human
   THP1 monocytes ([149]Figure S5C) [150]^31. Mith treatment inhibited
   GM-CSF-induced expansion of MDSCs (Figures [151]6P and S5D). Csf2R is a
   receptor of GM-CSF that controls the differentiation of the myeloid
   lineage [152]^32. Interestingly, we found that the expression of GM-CSF
   receptors (Csf2Ra and Csf2Rb) in FcγRIIB-KO HPCs were lower than that
   in WT HPCs (Figure [153]5C), suggesting a potential positive loop
   between GM-CSF and FcγRIIB that promoted the accumulation of
   immunosuppressive MDSCs. These data suggest that tumor cell-derived
   GM-CSF activates Sp1 signaling, leading to the upregulation of FcγRIIB
   and differentiation of MDSCs from HPCs.

Blocking Sp1-FcγRIIB signaling dampens immunosuppressive activity of MDSCs
and tumor progression

   We next assessed the role of FcγRIIB on tumor growth. The FcγRIIB
   specific antagonistic monoclonal antibody treatment suppressed MC38
   tumor growth and the percentage of tumor-infiltrating MDSCs. Similar
   results were observed by anti-Gr-1 neutralizing antibody treatment
   ([154]Figures S6A and S6B). However, combined treatment with anti-Gr-1
   neutralizing antibody and FcγRIIB antagonistic antibody did not induce
   further reduction of tumor volume and tumor-infiltrating MDSCs compared
   with mice treated with FcγRIIB antagonistic antibody alone
   ([155]Figures S6A and S6B). FcγRIIB blockade also led to increased
   proportions of CD8^+ T cells in the tumor and enhanced CD8^+ T cell
   activation ([156]Figures S6C and S6D). These data demonstrate that
   FcγRIIB is required for the immunosuppressive activity of MDSCs in
   vivo.

   Clinically, chemotherapeutic drugs including gemcitabine and 5-FU can
   selectively deplete levels of MDSCs and restore immune surveillance
   [157]^33. We found that treatment with gemcitabine inhibited the
   accumulation of MDSCs and delayed tumor progression (Figures [158]7A
   and S7A). Interestingly, expression of FcγRIIB in mMDSCs was increased
   after treatment with gemcitabine ([159]Figure S7B). We therefore
   speculated whether FcγRIIB inhibition by Sp1 inhibitor might have a
   synergistic effect with gemcitabine to inhibit tumor progression.
   Indeed, tumor growth was significantly suppressed by combined treatment
   of gemcitabine with Mith (Figure [160]7A). The proportion of
   tumor-infiltrating MDSCs was further decreased in mice in the combined
   treatment group than that in single treatment group (Figure [161]7B).
   As expected, treatment with Mith inhibited expression of FcγRIIB on
   MDSCs (Figure [162]7C). Moreover, inhibition of FcγRIIB led to enhanced
   infiltration and activation of CD8^+ T cells in gemcitabine-treated
   tumor-bearing mice (Figures [163]7D-F), suggesting that suppression of
   FcγRIIB could boost the anti-tumor response of chemotherapy.

Figure 7.

   [164]Figure 7
   [165]Open in a new tab

   Inhibition of FcγRIIB expression improves the anti-tumor effect of
   gemcitabine. (A-C) WT mice were injected subcutaneously with MC38 tumor
   cell. After 7 days, tumor-bearing mice were injected with PBS (Veh),
   gemcitabine (Gem, 50 mg/kg), Mithramycin A (Mith, 0.2mg/kg) or combined
   Gem with Mith (G+M). Tumor growth was monitored for 21 days (A). All
   mice were euthanized on day 21 after tumor injection, the percentages
   of MDSCs (B) and FcγRIIB expression on MDSCs (C) in tumor tissues were
   analyzed by FCM. (D-F) The percentages of CD8^+ T cells in tumor
   tissues (D), the percentage of CD8^+ T cells producing IFN-γ (E) and
   GzmB (F) in tumor tissues were analyzed by FCM. (G) Pearson's
   correlation coefficient was used to determine the correlation between
   FCGR2B and CD33. (H) Colon adenocarcinoma patient survival data were
   obtained from TCGA database, and overall survival probability was
   calculated using the Kaplan-Meier analysis, and the differences in
   survival curves were assessed using the log-rank test. (I, J) STAT3
   expression in MDSCs (I) and CD8^+ T cells percentages (J) in peripheral
   blood of patients with CRC versus healthy donor were analyzed by FCM, n
   = 7. Data are shown as means ± SD. One way ANOVA with Tukey multiple
   comparison post-test was used to evaluate statistical significance. ^*P
   < 0.05, ^**P < 0.01, ^***P < 0.001. ns, no significant difference.

   Finally, TCGA analysis showed that the expression of FCGR2B positively
   correlated with CD33, a marker of MDSCs (Figure [166]7G), and that
   higher FCGR2B expression was associated with poor survival in patients
   with CRC (Figure [167]7H). We also observed increased STAT3 expression
   in MDSCs and decreased CD8^+ T cells percentages in peripheral blood of
   patients with CRC (Figures [168]7I and [169]7J). Taken together, these
   results indicate that blockade of Sp1 is an efficient anti-tumor
   approach via reducing FcγRIIB-mediated accumulation and
   immunosuppressive activity of MDSCs in the TME.

Discussion

   MDSCs are a heterogeneous group of immature HPCs that function as
   pivotal immunosuppressors in the TME. Multiple evidence indicates that
   depletion of MDSCs by treatment with anti-Gr-1 neutralizing antibody or
   gemcitabine can restore immune surveillance and improve the efficacy of
   cancer immunotherapies in vivo [170]^10^, [171]^34. In the present
   study, we found that FcγRIIB was highly expressed on tumor-infiltrating
   MDSCs. Deficiency or blockade of FcγRIIB decreased the accumulation and
   immunosuppressive activity of MDSCs in the TME. Tumor cell-derived
   GM-CSF increased the expression of FcγRIIB on MDSCs, along with
   enhanced differentiation of MDSCs from HPCs by activating the Sp1
   signaling. Inhibition of Sp1 signaling significantly reversed
   GM-CSF-induced expression of FcγRIIB and the immunosuppressive activity
   of MDSCs, while synergistically enhanced gemcitabine-suppressed
   tumorigenesis. These findings indicate the critical role of
   GM-CSF/Sp1/FcγRIIB signaling pathway in tumor immunity and suggest
   potential therapeutic targets.

   FcγRIIB is the most widely expressed inhibitory Fcγ receptor in both
   human and mice. In previous studies, FcγRIIB expression in DCs has been
   reported can inhibit T cell response while anti-FcγRIIB antibody
   treatment results in up-regulation of IFN-induced genes [172]^35^,
   [173]^36. FcγRIIB has also been shown to negatively regulate
   cytotoxicity of NK cells, and antibody-producing B cells [174]^37.
   Recent study reported that FcγRIIB plays a cell-intrinsic role in
   suppressing tumor-infiltrating CD8^+ T cells [175]^17. Our current data
   shows that FcγRIIB regulates the immunosuppressive activity of MDSCs,
   and blockade of FcγRIIB promotes the anti-tumor T cell response through
   inhibiting the accumulation and the immunosuppression role of MDSCs.
   Moreover, FcγRIIB signaling promotes apoptosis in mature B cells in the
   absence of BCR ligation [176]^15. A recent study also demonstrates that
   FcγRIIB signaling promotes apoptosis in CD8^+ T cells in a
   Fgl2-dependent manner [177]^26. Here we found that elevated FcγRIIB
   expression on MDSCs did not promote apoptosis of MDSCs in tumor
   tissues, while the proportion of tumor-infiltrating gMDSCs increased.
   Mechanistically, tumor-derived GM-CSF increased the expression of
   FcγRIIB and subsequently promoted the differentiation of HPCs into GMPs
   and gMDSCs. Since tumor progression is associated with the abnormal
   differentiation of HPCs into MDSCs, and the gMDSC subset is the
   predominant MDSC population in tumor-bearing mice [178]^38; but the
   underlying mechanism driving abnormal myeloid cell differentiation in
   cancer remains poorly understood. The bone marrow chimerism experiment
   demonstrated the critical function of FcγRIIB in regulating the
   immunosuppressive activity and differentiation of MDSCs. Our study did
   not exclude the contribution of other immune cells in the anti-tumor
   immunity of FcγRIIB KO mice, but outlines the critical role of FcγRIIB
   in promoting gMDSCs generation during tumor progression.

   Stat3 signaling pathway is crucial for MDSC population expansion, and
   the activity of Stat3 increases in MDSCs during tumor-bearing
   conditions [179]^39. In our present study, Stat3 signaling pathway was
   significantly suppressed in FcγRIIB-deficient HPCs than in WT HPCs,
   suggesting that FcγRIIB might regulate differentiation of HPCs via the
   Stat3 signaling pathway. Moreover, FcγRIIB-deficient HPCs were
   positively enriched in HALLMARK gene sets for development or
   differentiation of erythrocytes. Erythrocytes are normally developed
   from MEPs in BM, although chronic infections and malignancies also
   induce erythropoiesis [180]^20. Tumor progression is often associated
   with anemia in patients [181]^40. However, how tumor development
   influences medullar erythropoiesis remains poorly understood. The
   results of the present study showed that tumor development prevented
   the differentiation of HPC into MEPs, while FcγRIIB deficiency enhanced
   HPCs differentiation into MEPs, even in tumor-free mice. Interestingly,
   FcγRIIB-deficient HPCs showed decreased Csf2R expression and would be
   less sensitive to GM-CSF stimulation, suggesting an intrinsic role of
   FcγRIIB in suppressing medullar erythropoiesis during tumor-initiated
   anemia.

   GM-CSF is an immune-modulatory cytokine that can promote the
   differentiation of immature progenitors into macrophages and DCs
   [182]^41. This cytokine has been used as an immunostimulatory adjuvant
   to induce anti-tumor immunity [183]^42. Nevertheless, it has been
   previously reported that GM-CSF production by tumors can directly
   suppress CD8^+ T cell activity by upregulating MDSCs [184]^43. Recent
   studies showed that knockdown of GM-CSF in tumor cells or blockade of
   GM-CSF with antibody reduces expansion of MDSCs, delays tumor
   progression, and enhances the efficiency of PD-L1 antibody [185]^44^,
   [186]^45, while the underlying mechanism remains vague. The present
   study showed that GM-CSF promoted the expression of FcγRIIB on MDSCs by
   activating Sp1 signaling. Blockade of Sp1 signaling suppressed the
   expression of FcγRIIB and dampened the expansion of MDSCs in the TME.
   Aberrant expression or activation of Sp1 has been found in various
   types of cancers [187]^46^, [188]^47, and increasing evidence suggests
   a crosstalk between Sp1 and Stat3 in tumors [189]^48. Therefore, Sp1
   and Stat3 may cooperatively activate targeted genes and mediate the
   immunosuppressive activity of MDSCs. Further investigation of
   regulatory pathways mediated by GM-CSF is necessary to expand the
   understanding of its role in tumor immunity.

   In summary, we report that FcγRIIB contributes to the immunosuppressive
   activity of MDSCs and the differentiation of HPCs into gMDSCs under
   tumor conditions. Tumor cell-derived GM-CSF promotes Sp1 binding to the
   FCGR2B promoter to increase the expression of FcγRIIB that subsequently
   activates the Stat3 signaling pathway to promote generation of gMDSCs
   in the TME. Moreover, blocking FcγRIIB decreases MDSC infiltration,
   promotes CD8^+ T cell activity in tumor-bearing mice, and improves the
   therapeutic efficacy of gemcitabine. These findings indicate that
   FcγRIIB is a potential anti-cancer target for immunotherapy.

Materials and methods

Human samples and databases

   Peripheral blood was collected from healthy adult volunteers and
   patients with CRC in Chongqing University Cancer Hospital, Chongqing,
   China. All experiments involving human subjects were conducted in
   accordance with local, national, and international regulations and were
   approved by the Ethics Committee of the Chongqing University Cancer
   Hospital, Chongqing, China. All patients provided written informed
   consent in accordance to the declaration of Helsinki before enrolling
   in the study. Mononuclear cells in peripheral blood were freshly
   isolated over lymphocyte separation medium (0850494X, MP Biomedicals).
   The expression of FcγRIIb in normal colon, colon adenocarcinoma, colon
   mucinous adenocarcinoma and rectal adenocarcinoma tissues were
   determined through analysis of Kurashina Colon cancer datasets, which
   are available at Oncomine ([190]http://www.oncomine.org/). All
   available TCGA data on Colon adenocarcinoma were obtained from the TCGA
   data portal (TCGA group). The RNA-seq data of colon cancer Patients (n
   = 597) were retrieved from cbioportal ([191]http://www.cbioportal.org).

Animals

   C57BL/6 mice were obtained from the Animal Institute of the Academy of
   Medical Science (Beijing, China). C57BL/6 wild type (WT) mice were
   purchased from the Chinese Academy of Medical Sciences (Beijing,
   China). EM:06078 Fcgr2b Fcgr2bB6null B6(Cg)-Fcgr2btm12Sjv/Cnbc
   (FcγRIIb^-/- mice) and Fgl2^-/- mice were kindly provided by J.S.
   Verbeek (Leiden University Medical Center, The Netherlands) and S.
   Smiley (The Trudeau Institute, NY, USA), respectively. OT-1 transgenic
   mice were purchased from the Jackson Laboratory. These mice were
   backcrossed for at least nine generations onto a C57BL/6 background,
   and their homozygous wild type littermates were used as controls. All
   mice were kept in specific pathogen-free conditions under a 12 h light
   cycle, and were given a regular chow diet at Chongqing University
   Cancer Hospital. All animal experiments were approved by the ethics
   committee of the Army Medical University. All animal studies were
   conducted in accordance with the national and international Guidelines
   for the Care and Use of Laboratory, and with the approval of the Animal
   Care and Use Committee (IACUC) of Army Medical University and Chongqing
   University Cancer Hospital (Chongqing, China, AMUWEC2017294) and
   complied with the Declaration of Helsinski.

Cell lines and treatment

   Murine colon adenocarcinoma cell line MC38 and melanoma cell line
   B16F10 were purchased from Type Culture Collection of the Chinese
   Academy of Sciences (Shanghai, China) in 2015 and cultured in DMEM
   (HyClone) containing 10% FBS (Gibco) containing 10% FBS and 1%
   penicillin-streptomycin. Human monocyte THP-1 Cells were purchased from
   ATCC. Cells were routinely verified Mycoplasma-free using
   MycAwayTM-Color One-Step Mycoplasma Detection Kit (Yeasen Bio-technol)
   and the most recent date of testing was April 12, 2021. These cells
   were authenticated and certified by ChengDu Nuohe Biotech co., LTD
   (Sichuan, China).

   For primary cell culture, single-cell suspensions of bone marrow (BM)
   cells derived from 8-10 week-old WT or KO mice were stained by
   anti-mouse Gr-1 particles (Cat No. 558111, BD Biosciences) and
   separated using the BD IMag Cell Separation Magnet. These harvested
   Cells were cultured in RPMI1640 medium containing 10% FBS supplemented
   with 20 ng/mL GM-CSF (315-03, PeproTech) and IL-6 (216-16, PeproTech)
   in the present or absence of STAT3-IN-1 (1μM, Cat No. S0818, Selleck)
   for 48 h to obtain BM derived MDSCs. For BM differentiation assays, BM
   cells from 8-10 week-old WT mice were cultured in RPMI1640 medium
   containing 10% FBS supplemented with 20 ng/mL GM-CSF (315-03,
   PeproTech) and IL-6 (216-16, PeproTech) in the present of Serum Amyloid
   protein/SAP (20 ng/mL, Cat No. ab276767, Abcam), C Reactive Protein
   (CRP) (20 ng/mL, Cat No. ab276840, Abcam) and Mouse IgG for 72 h. Mouse
   IgG was incubated with the goat F(ab′)[2] anti-mouse IgG (Cat No.
   ab98659, Abcam) for 60 min in PBS at 37 °C before adding to cells.

Tumor growth and treatments

   To establish an in vivo tumor model, 1× 10^6 MC38 or 5×10^5 B16F10
   cells were injected subcutaneously into the right flank of C57BL/6,
   FcγRIIb^-/- or Fgl2^-/- mice. Tumor growth was measured using calipers
   every 3 days. Tumor volume was calculated as follows: V= (length ×
   width^2) × 0.5. For Gr-1^+cell depletion studies, 250 µg anti-Gr-1
   neutralizing antibody (Cat No. BE0075, BioXcell, West Lebanon, USA) was
   administered i.p. every 3 days starting once tumors became palpable
   until the mice were sacrificed. FcγRIIb depletion in MC38-bearing mice
   was achieved by i.p. injections of 250 µg anti-mouse FcγRIIb antibody
   (clone AT128) every other day [192]^49. For in vivo treatments of
   gemcitabine (GEM, 50 mg/kg, Cat No. S1149, Selleck) and Mithramycin A
   (Mith, 0.2 mg/kg, Cat No. HY-A0122, Med Chem Express), treatment was
   initiated once tumor volume was approximately 100 mm^3, compounds were
   diluted in PBS and given i.p. every 3 days until the mice were
   sacrificed.

Flow Cytometry (FCM)

   Single-cell suspension samples of tumor, spleen and BM were harvested
   from euthanized mice at the indicated time points were prepared and
   blocked with rat IgG (10 μg/mL; Sigma) for at least 20 min on ice.
   Then, cells were labeled with the indicated antibodies (1:100) for 30
   min at 4 °C. Dead cells were excluded by using a Fixable Viability Dye
   Efluor 780 (Cat No. 65-0865-14, eBioscience) following manufacturer's
   instructions. The panel of antibodies used in these experiments
   included CD11b (Cat No. 101208), Gr-1 (Cat No. 108426), CD33 (catalog
   no. 303414), HLA-DR (catalog no. 307610), CD3 (Cat No. 100206), CD4
   (Cat No. 100412), CD8α (Cat No. 100706), CD11c (Cat No. 117308), CD103
   (Cat No. 121414), Ly6G (Cat No. 127626), Ly6C (Cat No. 128008), F4/80
   (Cat No. 123116), B220 (Cat No. 152406), PD-L1 (Cat No. 124308), CD45.1
   (Cat No. 110708), CD45.2 (Cat No. 109814), Sca-1 (Cat No. 108106),
   c-kit (Cat No. 105808), CD16/32 (Cat No. 101331), CD34 (Cat No. 119310)
   and APC Annexin V Apoptosis Detection Kit with 7-AAD (Cat No. 640930)
   from Biolegend (San Diego, CA). FcγRIIb (Cat No. 17-0321-80 and
   PA5-47122) was purchased from thermofisher, Lineage (Cat No. 561317)
   was from BD. For staining of Foxp3 (Cat No. 14-5773-82, eBioscience),
   ARG1 (Cat No. 42284, GeneTex), iNOS (Cat No. MA5-17139, Thermo), IFN-γ
   (Cat No. 505810, Biolegend), granzyme B (GzmB; Cat No. 515403,
   Biolegend), Ki67 (Cat No. 12075, CST), S100A8 (Cat No. 50-9745-42,
   eBioscience), Stat3 (1:1000; Cat No. 9139, CST) and Sp1 (Cat No.
   ab227383, Abcam), cells were stained surface markers, then fixed and
   permeabilized with Foxp3/Transcription factor staining kit (Cat No.
   00-5523-00, eBioscience), followed by primary/secondary antibodies
   staining according to the manufacturers' protocols. The proliferation
   and functional assay of CD8^+ T cells were performed as previously
   described [193]^10. CFSE probe was obtained from Dojindo (Cat No.
   C309). DCFH-DA (Cat No. S0033) probes were from Beyotime (Shanghai,
   China). FCM was performed on BD FACS Canto II platforms and results
   were analyzed with FlowJo software version 10.0.7 (TreeStar). The Mean
   fluorescence intensity (MFI) of antigen was determined by measuring the
   difference in mean channel fluorescence of positive staining cells
   subtract to unstained sample controls. Cell sorting was performed on an
   BD FACSAria II instrument (BD Biosciences).

BM reconstitution assay

   6-8-week-old male or female mice (CD45.1) were irradiated with 9.5 Gy
   (MultiRad 225, Faxitron). Subsequently, 1×10^7 BM cells (resuspended
   in100μL PBS) from WT or FcγRIIb-KO mice (CD45.2) were injected
   intravenously via the tail vein. 2 weeks after BM transfer, mice were
   given antibiotic water (containing 10mg/mL Trimethoprim and
   Sulfamethoxazole). To confirm BM reconstitution, the peripheral blood
   MDSCs from chimeric mice were assessed by flow cytometry using antibody
   against CD45.1 (Cat No. 110708, Biolegend) and CD45.2 (Cat No. 109814,
   Biolegend). The tumor model experiments were initiated at 6 weeks after
   BM reconstitution.

Transfection of shRNAs in MDSCs

   Three pLKD-CMV-EGFP-2A lentivectors containing shRNAs targeting Sp1 or
   a lentivector containing scrambled shRNA were obtained from Genechem
   (Shanghai, China). Sorted mouse CD11b^+Gr1^+ cells from BM were plated
   at 1× 10^6 cells per mL in 12-well plates and transduced with
   lentiviral particles (at MOI of 100) with 5µg/mL Polybrene
   (GenePharma). Cells were harvested and used for further experiments 3
   days after transfection.

ELISA

   The GM-CSF expression in serum, BM and tumor tissues of MC38 tumors
   bearing WT and FcγRIIb^-/- mice were measured using a Mouse GM-CSF
   ELISA Kit (Cat No. 432207, Biolegend) according to the manufacturer's
   instruction.

Immunofluorescence

   Mice tumor samples were fixed with 4% formaldehyde for 15 min and
   tissue sections were then incubated in 10% normal goat serum for 1 h.
   The cells were then incubated with the primary antibody Gr-1 (1:50, Cat
   No. MAB1037, R&D Systems) and CD8α (1:50, Cat No. GTX74642, GeneTex) at
   4 °C overnight. The secondary antibody Anti-rat IgG (H+L) Alexa Fluor
   488 Conjugate (Cat No. 4416, CST) was used at a 1:200 dilution for 1 h.
   DAPI was used to stain the nucleus at a concentration of 100 ng/mL.
   Then, the sections were imaged on a Leica TCS SP5 confocal microscope
   (Leica Microsystems).

Quantitative real-time PCR

   Total RNA was extracted from cells using RNAiso Plus (TAKARA, Japan)
   and the RNA concentration in the samples was measured using NanoDrop
   2000 (Thermo Scientific). 1 µg total RNA was converted to complementary
   DNA (cDNA) using the PrimeScript RT-PCR Kit (RR014A, Takara) according
   to the manufacturers' instructions. Quantitative real-time PCR (qPCR)
   was performed using TB Green Fast qPCR Mix Kit (RR430A, Takara) on a
   CFX384 system (BIO-RAD), and the relative quantification (2-^ΔΔCt)
   method was used to analyze gene expression. β-actin mRNA was used as a
   reference for mRNA quantification. All qPCR experiments were repeated
   at least three times. Primer sequences were as following:

   Cxcl1-F: (5′- GCCTCTAACCAGTTCCAGCA-3′); Cxcl1-R:
   (5′-TTGAGGTGAATCCCAGCCAT-3′); Cxcl2-F: (5′-GGCAAGGCTAACTGACCTGG-3′);
   Cxcl2-R: (5′-CTCAGACAGCGAGGCACATC-3′); Cxcl5-F:
   (5′-CTCTGTTCAGCTATTGGACGC-3′); Cxcl5-R: (5′-GAACACTGGCCGTTCTTTCC-3′);
   Cxcl12-F: (5′-GGTGCTCAAACCTGACGGTA-3′); Cxcl12-R:
   (5′-GGCAGCTCCTCTTTGGCTTA-3′).

RNA sequencing library construction

   Total RNA was isolated from sorted BM HPCs (lin^-, Sca-1^-, c-kit^+)
   from WT and FcγRIIb^-/- tumor-bearing mice on day 21 after MC38 tumor
   cell implantation. The RNA-seq library for these RNA samples was
   constructed according to the strand-specific RNA sequencing library
   preparation protocol. mRNA transcripts were enriched by two rounds of
   poly-(A+) selection with Dynabeads oligo-(dT) 25 (Invitrogen) before
   library construction. The prepared libraries were sequenced on an
   Illumina Novaseq 6000 platform.

Chromatin immunoprecipitation (ChIP) assay

   Chromatin immunoprecipitation (ChIP) assays were performed using a
   Simple ChIP Plus Enzymatic Chromatin IP Kit (Cat No. 9005, CST)
   according to the manufacturers' instructions. In brief, chromatin from
   BM-derived MDSCs were chemically cross-linked with 1% formaldehyde
   solution for 10 min at room temperature and quenched with 0.125 M
   glycine. The fixed cells were resuspended, and lysised DNA to length of
   approximately 150-900 bp and immunoprecipitated with ChIP-validated Sp1
   antibody (Cat No. ab227383, Abcam) and IgG (Cat No. 3900, CST). DNA
   samples were purified and amplified by four pairs of ChIP-PCR primers
   that designed to amplify the region containing each Sp1 binding site at
   the FcγRIIb promoter. The amplified products were analyzed by agarose
   gel electrophoresis. The primer sequences used were as following:

   -1385~-1376-F ACCTCTACTGCCATCAGC,

   -1385~-1376-R TTCCACCCTATCTACCCT;

   -562~-553-F CGAATGGGTAGAAATGTTGATC,

   -562~-553-R GTCTGTGCCCTAGTCCTGAA.

FcγRIIB promoter luciferase reporter assay

   To measure the effect of Sp1 on FcγRIIB expression in HPCs, the FcγRIIB
   promoter region (-1500 ~ +1 from the transcription starting site) was
   synthesized by GenScript co., LTD (Nanjing, China) and subcloned into
   pGL3-basic vector (Promega, Madison, WI, USA), Sp1 binding site 5'-
   GGGGCGGGGC was mutated to 5'-AAGGCAAGGC. Lentivectors containing Sp1
   overexpression or a lentivector containing mock were obtained from
   Genechem (Shanghai, China). The HPCs were transfected with 1 μg of
   reporter vector and 20 ng of pSV-Renilla expression vector (mock and
   Sp1) using Advanced DNA RNA Transfection Reagent (Cat No. AD600025,
   Zeta-life). Transfected cells were incubated for 48 h, Luciferase and
   Renilla activities were measured using the dual-luciferase reporter
   system kit (Cat No. E1910, Promega). The transfection was performed
   according to the manufacturer's protocol.

Western blotting

   Single-cell suspensions of BM cells from 8-10 week-old WT or KO mice
   were stained by anti-mouse Gr-1 particles (Cat No. 558111, BD
   Biosciences) and separated by the BD IMag Cell Separation Magnet. These
   harvested cells were cultured in RPMI1640 medium containing 5% FBS
   supplemented with 10% tumor supernatants from MC38 cells or 20 ng/mL
   GM-CSF for 48 h. Cells were lysed by RIPA lysis buffer, and the cell
   lysates were incubated on ice for 30 min and centrifuged at 13,000g, 4
   °C for 15 min before the supernatants were collected. Western blot
   analysis was performed as previously described [194]^10. The primary
   antibodies included anti-Sp1 (1:1,000; Cat No. ab227383, Abcam) and
   anti-Actin (1:1,000; Cat No. A1978, Sigma-Aldrich).

Statistical analysis

   All results were confirmed in at least three independent experiments
   and were expressed as means ± SD. Mann-Whitney test and one- or two-way
   ANOVA were used for calculation statistical significance with GraphPad
   Prism software (version 8.0). The Kaplan-Meier method was used to
   assess overall survival, and the differences in survival curves were
   analyzed using the log-rank test. P < 0.05 was considered statistically
   significant.

Supplementary Material

   Supplementary figures.
   [195]Click here for additional data file.^ (2.5MB, pdf)

Acknowledgments