Abstract
The fruits of Ailanthus altissima Swingle (AS) possess a variety of
pharmacological activities. Its antioxidant activity and the potential
mode of action have not yet been investigated. In in vitro studies, AS
revealed the strong reducing power and DPPH scavenging effect, but
hydroxyl radical scavenging activity and ferrous ions-chelating ability
were not strong. Meanwhile, the oxidative stress RAW264.7 cell injury
model was established, the low and medium-doses of AS showed
significant protective effects on the viability of H[2]O[2]-treated
cells by CCK-8 method. Besides, three doses of AS all increased the
activities of SOD, CAT, and GSH-Px and decreased the MDA level compared
with the H[2]O[2] group, suggesting it significantly relieved oxidative
stress of cells. The active ingredients and related targets of AS were
collected by HERB and Swiss Target Prediction database, the common
targets of drugs and diseases database were conducted by GeneCards
database platform and the Venny platform. We screened the core targets
of AS like threonine kinase1 (AKT1), mitogen-activated protein kinase 1
(MAPK1), sirtuin-1 (SIRT1), mechanistic target of rapamycin kinase
(MTOR) by STRING database, and the key pathways involved PI3K-AKT and
FoxO signaling pathway by KEGG pathway enrichment analysis. Besides,
qRT-PCR revealed AS preconditioning significantly up-regulated the
expression level of AKT1, SIRT1, MAPK1, and MTOR in model cells, and
the effect was related to the regulation of FoxO and PI3K/AKT signaling
pathway. In summary, AS showed significant antioxidant activity and its
potential mechanism was regulating FoxO and PI3K/AKT signaling pathway.
Keywords: Ailanthus altissima Swingle, antioxidant activity, RAW264.7
cell, network pharmacology, in vitro, antioxidant mechanism
Introduction
Oxidative stress is the imbalance between oxidation and antioxidant
reaction caused by the accumulation of free radicals in the body
([45]1). Cells produce free radicals through multiple metabolic
pathways, and free radicals are crucial factors that give rise to
oxidative damage of proteins, showing high reactivity ([46]2). Reactive
oxygen species (ROS) are the uppermost free radicals in cells and
mainly produced by mitochondria ([47]3). Excess ROS break down cells
and tissues, affect metabolic function, and cause different health
problems ([48]4). In addition, previous studies have indicated that
oxidative damage to proteins caused by ROS has something to do with
aging, the occurrence of atherosclerosis, arthritis, cancer, and
neurodegenerative diseases such as Alzheimer's and Parkinson's disease
([49]5–[50]7). Cells maintain ROS homeostasis through superoxide
dismutase (SOD) system, catalase (CAT) system, glutathione peroxidase
(GSH-Px) system, etc. ([51]8).
Antioxidants are a class of substances that help trap and neutralize
free radicals, thereby they can decrease the damage to the body caused
by free radicals. Additionally, antioxidants play a protective role
against certain diseases including inflammation and cancer caused by
oxidative stress ([52]9, [53]10). Antioxidants are classified as
synthetic antioxidants and natural antioxidants generally. However,
considering several synthetic antioxidants have presented toxicity and
side effects, especially with long-term use ([54]11–[55]13), the
exploration of safe and side-effect-free natural antioxidants has
become a hot spot for the past few years. Some natural products,
chiefly the extracts of some medicinal plants, have strong antioxidant
activity with little toxicity and side effects ([56]14). For this
reason, antioxidants from natural sources have a good application
prospect in the prevention and treatment of various diseases related to
oxidative stress.
Ailanthus altissima (Mill.) Swingle (Simaroubaceae), the
tree-of-heaven, is an early successional tree, native to China and
North Vietnam ([57]15). Its fruit is a traditional Chinese medicine,
named “FENG YAN CAO” in Chinese, which has the effect of clearing heat
and dryness, stopping dysentery and bleeding, and can also be used to
treat diarrhea, heat ailments, epilepsy, trichomonas vaginalis, and
ophthalmic disease ([58]16, [59]17). Previous studies on the
composition of AS have revealed the presence of alkaloids, terpenoids,
steroids, and flavonoids ([60]18). Jin et al. ([61]19) found a
decoction of Ailanthus altissima (AS) could inhibit inflammatory
cytokines production, such as TNF, IL-6, IL-8, as well as NF-κB. The
EtOH extract of AS decreased the generation of the
cyclooxygenase-2-dependent phases of prostaglandin D2 in bone
marrow–derived mast cells ([62]20). A variety of studies have
investigated the anti-inflammatory effects of AS, while little research
has been done to reveal the antioxidant effects of AS. Therefore, this
paper focused on investigating in vitro and intracellular antioxidant
activity and the potential mechanism of AS based on network
pharmacology.
This experiment investigated antioxidant activities of AS in vitro and
its protective effect on H[2]O[2]-induced RAW 264.7 cells. Besides, we
explored the potential antioxidant mechanism of AS based on network
pharmacology analytical methods and verified it to some extent by
qRT-PCR, aiming to provide reference for development of AS and other
traditional natural products.
Materials and Methods
Material Preparation
The fruits of Ailanthus altissima Swingle were purchased from Bozhou
Baohua Pharmaceutical Co., Ltd., in August 2020. The plant specimen
(2020011) was deposited in Key Laboratory of Veterinary Pharmaceutical
Development of Ministry of Agriculture, Lanzhou Institute of Husbandry
and Pharmaceutical, Chinese Academy of Agricultural Sciences. The
AS-extractum was extracted with 95% ethanol by reflux four times, and
the extracted solution was combined and concentrated under reduced
pressure to remove the ethanol.
Materials and Reagents
2, 2-diphenyl-1-picrylhydrazyl (DPPH) was purchased from TCI Shanghai,
ethylene diamine teraacetic acid (EDTA) and ascorbic acid (VC) were
purchased from Sinopharm Chemical Reagent Co. (Shanghai, China); all
other chemicals used were analytical grade and bought from local
suppliers. Dulbecco's modified Eagle's medium (DMEM) high glucose and
fetal bovine serum were purchased from HyClone (Ultah, US) and Gibcol
Life Technology (New York). Cell Counting Kit-8 (CCK-8) was purchased
from Biosharp Life Sciences (Hefei, China). CAT, SOD, GSH-Px, and MDA
assay kits were obtained from Solarbio Science and Technology Co., Ltd.
(Beijing, China). Murine macrophage cell line RAW264.7 cells were
purchased from the Type Culture Collection of Chinese Academy of
Sciences (Shanghai, China). Simply P Total RNA Extraction Kit was
purchased from BioFlux (Hangzhou, China). Prime ScriptTM RT reagent Kit
with gDNA Eraser and TB Green^® Premix Ex Taq™ II were obtained from
Takara (Beijing, China).
Antioxidant Assay in vitro
Scavenging Activity Against DPPH Free Radical
The DPPH free radical scavenging activity of alcohol extract from AS
was measured and modified slightly according to a previous method by
Guo et al. ([63]21). The 1 mM DPPH solution dissolved in 75% ethanol
was prepared and protected from light prior to measurement. A total of
100 μL of the alcoholic extract of AS in different concentrations was
mixed fully with 200 μL DPPH solution separately in 96-well-plates. The
final concentration of the extract was 1, 0.5, 0.25, 0.125, 0.0625,
0.03125, and 0.015625 mg/mL, respectively. The mixture was placed in
the dark for 30 min, and the absorbance value was measured at 517 nm.
VC was used as a positive control. Each sample was repeated three
times. The scavenging rate of the DPPH free radical was calculated
using the following equation:
[MATH: Scavenging effect(%) = [1-(Ai-Aj)/A0]×100% :MATH]
where A[0] is the absorbance of the DPPH solution without sample; A[i]
is the absorbance of the test sample mixed with DPPH; and A[j] is the
absorbance of the sample without DPPH.
Ferrous Ion-Chelating Ability
The chelating capacity of ferrous ions was determined based on the
method described by Senevirathne ([64]22) with some modifications. The
chelating ability of alcohol extract from AS was determined by using
ferrozine. A total of 100 μL of different concentrations of the AS
extract was transferred to the 96-well-plate. Then, it was mixed with 5
μL of the FeCl[2] solution (2 mM), 20 μL of the ferrozine (5 mM), and
75 uL of the distilled water successively. Let stand for 10 min at room
temperature. The absorbance value was measured at 560 nm. The ferrous
ion-chelating ability was calculated by the equation:
[MATH: The ferrous ion-chelating ability(%) = [1-(Ai-Aj)/A0]
×100%
:MATH]
where A[i] is the absorbance of the extract sample mixed with the
reaction solution. A[j] is the absorbance measured with distilled water
instead of ferrozine. A[0] is the absorbance measured with distilled
water instead of the extract sample.
Hydroxyl Radical Scavenging Activity Assay
The method we used was modified based on previous reporting ([65]23).
We mixed 50 μL of the alcohol extract solution of AS (0.0625–4 mg/mL)
and 50 μL of the 6 mM FeSO[4] solution together. Then add 50 μL of the
6 mM salicylic acid-ethanol and the same H[2]O[2] solution into the
mixture, respectively. The mixture incubated at 37°C for 30 min. The
absorbance of the mixture was measured at 510 nm against a blank. The
hydroxyl radical scavenging ability was calculated by the following
equation.
[MATH: Scavenging effect(%) = [1-(Ai-Aj)/A0]×100 :MATH]
where A[i] is the absorbance of the extract sample mixed with the
reaction solution. A[j] is the absorbance measured with distilled water
instead of H[2]O[2]. A[0] is the absorbance measured with distilled
water instead of the extract sample.
Ferric-Reducing Power Assay
The ferric reducing power of alcohol extract from AS was determined and
minor modifications were made according to the method of Shang
([66]11). A total of 100 μL of the alcoholic extract of AS in different
concentrations was mixed fully with 250 μL of sodium phosphate buffer
(pH 6.6) and 250 μL of potassium ferricyanide (1%, w/v). There was 250
μL of trichloroacetic acid (10 wt%) added after the mixture has been
reacted at 50°C for 20 min. The commixture was centrifuged at 4,000 rpm
for 10 min. There was 50 μl of supernatant taken and mixed with 50 μl
of distilled water and 50 μl of ferric chloride (0.1 wt%) in the
96-well-plate. Mix it well and let it stand for 10 min. The absorbance
was measured at 700 nm. VC was the positive reference reagent. All in
vitro experiments were performed at least in triplicate.
Measurement of Effect Against H[2]O[2]-Induced Oxidative Stress
Cell Culture
RAW264.7 was incubated in a DMEM high glucose medium supplemented with
10% fetal bovine serum and maintained at a temperature of 37°C within a
humidity incubator containing 5% CO[2].
CCK-8 Assay
RAW264.7 cells were seeded in 96-well-plates at a density of 1 × 10^6
cells/mL in culture medium for 4 h. Cells were exposed to 100 μL of
culture medium containing different concentrations of AS (dissolved in
sterile water) or H[2]O[2] and incubated for 24 h. Detection of cell
viability stimulated with AS under oxidative stress was performed as
follows: cells with a density of 1 × 10^6 cells/mL were seeded in
96-well-plates and incubated for 4 h. Then they were exposed to fresh
DMEM with different concentrations (0, 30, 50, and 70 μg/mL) of AS for
20 h. The positive control group and the AS-treated groups were then
treated with H[2]O[2] (400 μM) for 4 h. After that, the culture medium
was removed and washed with phosphate buffered saline (PBS), and then
100 μL CCK-8 solution (100 μL DMEM for 10 μL CCK-8) was added to each
well. The absorption values were measured at 450 nm, using a microplate
reader (BioTek, USA), after incubation at 37°C for 4 h. The results
were indicated as the percentage viability according to the following
equation:
[MATH: Viability (%) = (At-A0)/ (Ac-A0)×100% :MATH]
where A[t] is the absorbance of the treatment group. A[0] is the
absorbance of the blank control group. A[c] is the absorbance of the
control group.
Evaluation of Antioxidant Enzyme Activity and Lipid Peroxidation
RAW264.7 cells were seeded in 6-well-plate at a density of 1 × 10^6
cells/mL in culture medium for 4 h and stimulated with AS (0, 30, 50,
and 70 μg/mL) for 20 h. The positive control group and AS-treated
groups were then exposed to H[2]O[2] (400 μM) for 4 h. The activity of
SOD, CAT, GSH-Px, and MDA in cells was determined using a commercial
kit according to the manufacturer's instructions.
Network Pharmacology Analysis
Related Gene Targets Database Construction
The active ingredients of AS were manually obtained by searching “FENG
YAN CAO” in HERB (Available online: [67]http://herb.ac.cn/). In
addition, the screening conditions were limited to drug likeness ≥0.18
in Swiss ADME (available online: [68]http://www.swissadme.ch/). Second,
the SMILE structure of known active ingredients was obtained by PubChem
database (available online: [69]https://pubchem.ncbi.nlm.nih.gov/),
which was imported into Swiss TargetPrediction database (available
online: [70]http://www.swisstargetprediction.ch/) to obtain the target
gene corresponding to the active ingredient ([71]24).
Common Targets of Drugs and Diseases Database Construction
The GeneCards database platform (available online:
[72]https://www.genecards.org/) was used to retrieve the keyword
“anti-oxidation” to collect target genes associated with oxidation.
Then the common target genes of the active component target genes of AS
and antioxidant target genes were obtained by the Venny platform
(available online: [73]http://bioinfogp.cnb.csic.es/tools/venny/)
([74]25, [75]26).
Construction of Protein-Protein Interaction Network and Screening of Core
Targets
The potential targets of AS in the treatment of oxidative stress were
imported into the STRING database (available online:
[76]https://string-db.org/). Set the conditions “Minimum required
interaction score=0.4” and “Hide disconnected nodes in the network” to
obtain protein interaction information including the node degree value.
PPI network diagram was drawn by Cytoscape_v3.6.0. The core targets
were selected according to the node degree value ([77]27, [78]28).
GO Analysis and KEGG Enrichment Analysis of Core Target Gene
In short, computational R-package of “ClusterProfiler version 4.1.0”
was applied for the enrichment analysis of gene ontology (GO) in
molecular function (MF), cellular component (CC), and biological
function/process (BP), and Kyoto Encyclopedia of Genes and Genomes
(KEGG) pathway enrichment analysis was performed by Metascape
(available online: [79]https://metascape.org/gp/index.html) on the
common targets ([80]29). Furthermore, the visualization bubble chart
and histogram were formed and displayed.
qRT-PCR Verification Assay
RAW264.7 cells were treated with AS (0, 30, 50, and 70 μg/mL) for 20 h
as previously described. They were then exposed to H[2]O[2] (400 μM)
for 4 h and the negative control groups were incubated without
treatment for 28 h. We used Simply P Total RNA Extraction Kit to
extract total RNA. RNA extract was subsequently DNase treated by using
Prime Script^TM RT reagent Kit with gDNA Eraser following the
manufacturer's instructions. Reverse transcription of RNA and the
quantitative expression of the genes was performed with TB Green^®
Premix Ex Taq™ II according to the manufacturer's instructions. In
addition, real time quantitative PCR was performed on QuantStudio 6
Flex (ABI, US). The reaction condition was subjected to an initial
predegeneration step at 95°C for 30 s, followed by 40 cycles of 95°C
for 5 s and 60°C for 34 s and the last 95°C for 15 s, 60°C for 1 min,
and 95°C for 15 s. The target genes were amplified with the primers in
[81]Table 1, and GAPDH was used as the internal reference gene. The
total reaction system was 20 μL, each reaction was repeated three
times, and the QuantStudio^TM Real-Time PCR software was used for
analysis. The expression quantity of the target genes was calculated by
the 2^−ΔΔCT method.
Table 1.
Primers used for qRT-PCR.
Gene symbol NCBI RefSeq no. Sequence (5′→3′)
GAPDH [82]NC_000072.7 (F)GGTTGTCTCCTGCGACTTCA
(R)TGGTCCAGGGTTTCTTACTCC
AKT1 [83]NC_000078.7 (F) ACAGCCTCCCTCCATCACTTCAG
(R) TACCCACAATCTACCTCCCACCATC
MTOR [84]NC_000070.7 (F) TCCATTCCGTCAGCAGCATTGTC
(R) TCAGCCACACTCCTCATCCTCAC
MAPK1 [85]NC_000077.7 (F) GGTATCCAGCACATGATCCACAGTC
(R) GCAAGCGTTCTACATCAAGTTACATCC
SIRT1 [86]NC_000076.7 (F) GGATGGCCAGACTTTGCAGC
(R) CACCAGGGTCCTGCATCCAT
[87]Open in a new tab
Statistical Analysis
Experimental data was expressed as the mean ± SE of three independent
experiments and analyzed by ANOVA using IBM SPSS Statistics 23. P <
0.05 were considered statistically significant.
Results and Discussion
Antioxidant Assay In vitro
Scavenging Activity Against DPPH Free Radical
DPPH method is one of the most well-known methods for assessing
antioxidant activity in vitro ([88]30, [89]31). [90]Figure 1A showed
the scavenging activities of AS on the DPPH radical compared with VC.
At the lowest concentration (15.625 μg/mL), AS still had a scavenging
effect of 20.95% for DPPH. What is more, the scavenging activity was
increased with the rise of the concentration of the extract of AS,
which could indicate a close-dependent relationship between the
scavenging effect and the concentration of AS in the range of 15.625
μg/mL to 1 mg/mL. When the concentrations of AS were 0.5 and 1 mg/mL,
the scavenging rates of DPPH free radical were 91.97 and 97.90%, even
greater than DPPH radical scavenging activity of VC at the same
concentration. VC is recognized as a powerful antioxidant. So, compared
with VC, we thought AS presented extremely strong scavenging effects on
DPPH free radical.
Figure 1.
[91]Figure 1
[92]Open in a new tab
Antioxidant activities of AS at different concentrations (A) DPPH
radical scavenging activity of AS and VC. (B) Ferrous ion-chelating
rate of AS and EDTA-2Na. (C) Hydroxyl radical scavenging activity of AS
and VC. (D) Reducing power of AS and VC. Data are shown as the mean ±
SD (n = 3) ([93]Supplementary Table 4).
Ferrous Ion-Chelating Ability
Antioxidants are commonly used as metal ion chelators to prevent free
radical chain reactions ([94]32). As can be seen from [95]Figure 1B,
ferrous ion-chelating ability remarkably increased with the elevation
of AS levels from 125 to 1,000 μg/mL. The chelating ability of AS was
53.94% under the concentration of 1,000 μg/mL, so the EC[50] was
roughly speculated to be 1,000 μg/mL in general. While the chelating
rate of EDTA-2Na was 41.78 and 80.75% at 31.25 and 62.5 μg/mL,
respectively. The EC[50] of EDTA-2Na was nearly 46.88 μg/mL. As we all
know, EDTA-2Na is a strong complexing agent, always used for chelating
metal ions and separating metals. Thus, compared with EDTA-2Na, we
supposed that AS has certain ferrous ion-chelating ability, but this
ability was not strong.
Hydroxyl Radical Scavenging Activity Assay
Hydroxyl radical is the most active reactive oxygen species, which can
directly react with lipids and their main oxidation products ([96]33).
So, the ability of antioxidants to remove existing hydroxyl radicals is
important. We found AS had the hydroxyl radical scavenging ability at
the concentration between 15.625 and 1,000 μg/mL as shown in [97]Figure
1C. Moreover, the scavenging activity of AS was significantly
concentration dependent. The scavenging ability of AS was lower than
that of VC. However, VC itself had an extreme scavenging activity
against hydroxyl radicals. This result was also represented in the
figure. The hydroxyl scavenging rate of AS was 42.34% at the highest
concentration (1,000 μg/mL), lower than 50%, while the DPPH scavenging
rate of 50% was detected between 15.625 and 31.25 μg/mL. So, the EC[50]
of AS was more than 1,000 μg/mL and the EC[50] of VC was nearly 23.44
μg/mL. The hydroxyl radicals scavenging capacity of AS was weak in
comparison with VC. Therefore, AS had a stronger scavenging capacity
for DPPH than hydroxyl radicals. According to previous experiments, the
antioxidant mechanism might be due to the supply of hydrogen by
antioxidants, which were bound to free radicals and formed stable free
radicals to terminate the free radical chain reaction or combine with
radical ions ([98]34, [99]35). Hence, it could conceivably be the
hypothesis that AS could be used as electron or hydrogen donors to
scavenge radicals.
Ferric-Reducing Power Assay
[100]Figure 1D illustrated that within the range of experimental
concentration, the reducing power of AS showed a certain positively
correlated dose-effect relationship. The curve shape of AS was similar
to VC, but the reducing power of the sample was slightly weaker than
VC. The absorbance (700 nm) of AS was 1.03, while that of VC was 1.15
under the concentration of 500 μg/mL. This result identified the
reducing power of AS was close to VC. Based on the strong reducing
power of VC, we concluded AS had a strong reducing power. The reducing
power of antioxidants was generally achieved by giving away hydrogen
atoms or breaking free radical chains ([101]36). Polyphenols have a
structure in which the benzene ring is linked to the hydroxyl group and
the hydrogen on the hydroxyl group linked to the benzene ring is
unstable and is usually a very good donor of hydrogen or electrons
([102]37). Therefore, AS has a strong reducing ability maybe due to the
polyphenols in AS.
Based on the previous findings, we hold the opinion that AS has the
strong reducing power and DPPH the scavenging effect. In addition,
hydroxyl radical scavenging activity and ferrous ions-chelating ability
are not the key factors that affect the antioxidant potential of AS.
Therefore, we speculate that AS supply hydrogen or electrons and break
free radical chains to achieve an antioxidant effect.
Measurement of Effect Against H[2]O[2]-Induced Oxidative Stress
The Effect of H[2]O[2] and AS on the Proliferation of RAW264.7 Cells
CCK-8 analysis was used to determine the effect of different
concentrations of H[2]O[2] and AS on cell viability. It was apparent
from [103]Figure 2 that with the increasing concentration of hydrogen
peroxide, cell viability decreased significantly. When the
concentration of hydrogen peroxide was higher than 200 μM, the
suppression of cell viability was extremely significant (p < 0.01). The
cell viability was 52.29% at the concentration of 400 μM, indicating
that IC[50] of H[2]O[2] was approximately 400 μM. Therefore, the
H[2]O[2] concentration of 400 μM was selected here for subsequent
mechanism study.
Figure 2.
Figure 2
[104]Open in a new tab
The effect of H[2]O[2] on the viability of RAW264.7 cells. Cells were
treated with different concentrations of H[2]O[2] for 24 h. The results
were presented as the mean ± SE of three independent experiments. **P <
0.01 compared with normal cell group ([105]Supplementary Table 9).
As shown in [106]Figure 3, when the cells were treated with AS at a
concentration >100 μg/mL, a significant drop in cell viability was
discovered (p < 0.05). This demonstrated that AS showed cytotoxic
effect at 100 μg/mL and was not toxic to cells in the range of 30–70
μg/mL. Besides, the cell viability was significantly improved in the
groups dealt with 30 μg/mL AS (p < 0.05), while the groups treated with
50 μg/mL AS had the highest cell viability (p < 0.01). We speculated AS
may promote the proliferation of RAW264.7 cells within this
concentration range. As a result, the low-, medium-, and high-dose of
AS were selected as 30, 50, and 70 μg/mL, and taken the concentration
as the recommended dose for subsequent experiments.
Figure 3.
Figure 3
[107]Open in a new tab
The effect of AS on the viability of RAW264.7 cells. Cells were treated
with different concentrations of AS for 24 h. The results were
presented as the mean ± SE of three independent experiments. *P < 0.05
and **P < 0.01 compared with the normal cell group ([108]Supplementary
Table 8).
As shown in [109]Figure 4, the cell viability of the H[2]O[2] group was
significantly reduced compared with the normal group (p < 0.01). The
cell viability was significantly improved in the low- and medium-dose
groups (p < 0.05). When the AS concentration was 70 μg/mL, there was no
significant difference in cell viability compared with the H[2]O[2]
group. The result of the H[2]O[2] group revealed 400 μM H[2]O[2] and 4
h incubation was sufficient to suppress the multiplication of RAW264.7
cells. What is more, low and medium doses of AS showed significant
protective effect on the viability of H[2]O[2]-treated cells. According
to previous antioxidant assay in vitro, AS was highly related to free
radicals including hydroxyl radical scavenging effects, and this could
further explain that AS showed improvement to the viability of RAW264.7
cells may benefit from its antioxidant.
Figure 4.
Figure 4
[110]Open in a new tab
The effect of AS on the viability of RAW264.7 cells induced by
H[2]O[2]. Cells were treated with different concentrations of AS for 20
h. The positive control group and AS-treated groups were then exposed
to H[2]O[2] (400 μM) for 4 h. The results were presented as the mean ±
SE of three independent experiments. *P < 0.05 compared with the normal
cell group, **P < 0.01 compared with the normal cell group. ^#P < 0.05
compared with H[2]O[2], ANOVA analyses ([111]Supplementary Table 7).
Evaluation of Antioxidant Enzyme Activity and Lipid Peroxidation
In order to know more about the antioxidant effect of AS, we measured
the antioxidant enzyme activity and lipid peroxidation degree of the
cells treated with AS under oxidative stress. As shown in [112]Figure
5A, SOD activity significantly increased in the three groups treated
with AS compared with H[2]O[2] group (p < 0.01). In addition, we found
CAT activity in the AS-treated groups was significantly higher than
that in the positive control group (p < 0.01) in [113]Figure 5B. Both
the medium-dose and high-dose groups recovered to levels
indistinguishable from the negative control group (p > 0.05). As can be
seen from [114]Figure 5C, the MDA level of the H[2]O[2] group was
significantly higher than that of the negative control group after the
cells were damaged by H[2]O[2] (p < 0.01). After AS treatment, the MDA
level of cells was significantly lower than that of the H[2]O[2] group
(p < 0.01). From [115]Figure 5D we could see the GSH-Px activity in
AS-treated groups was significantly up-regulated in comparison with the
H[2]O[2]-treated group (p < 0.01). In addition, the activity of GSH-Px
in the low-dose group was the highest among the AS-treated groups.
Moreover, the MDA experiment showed that the oxidative damage level of
the low-dose group is the lowest, consistent with this result.
Figure 5.
[116]Figure 5
[117]Open in a new tab
Evaluation of antioxidant enzyme activity and lipid peroxidation. (A)
The effect of AS on the activity of SOD. (B) The effect of AS on the
activity of CAT. (C) The effect of AS on the cellular concentration of
MDA. (D) The effect of AS on the activity of GSH-Px. The results were
expressed as the mean ± SE of three independent experiments. *P < 0.05
compared with the normal cell group, **P < 0.01 compared with the
normal cell group. ^##P < 0.01 compared with H[2]O[2], ANOVA analyses
([118]Supplementary Table 5).
These results indicated H[2]O[2] caused oxidative damage to RAW264.7
cells, and the three doses of AS all had a certain protective effect on
cells and effectively reduced the oxidative damage of macrophages. SOD
catalyzes superoxide anions into H[2]O[2] and O[2], to achieve the
purpose of scavenging free radicals. It plays a crucial role in the
balance of oxygen utilization by the body ([119]38). Both CAT and
GSH-Px are important peroxidase enzymes that exist widely in the body.
GSH-Px catalyzes glutathione (GSH) to form glutathione (oxidized)
(GSSG), and that CAT collaborates with GSH-Px to reduce toxic hydrogen
peroxide to non-toxic hydroxyl compounds ([120]39, [121]40). MDA is one
of the important products of membrane lipid oxidation, and its content
reflects the level of free radical attack and indirectly indicates the
damage degree of the cell membrane system ([122]41). Through these
findings, three doses of AS all alleviated the oxidative damage to a
certain extent, decreased the MDA level, and maintained the oxidative
balance of cells. Here, we confirm AS can increase the activities of
SOD, CAT, and GSH-Px to reduce the damage of H[2]O[2] to cells.
Network Pharmacology Analysis
Related Gene Targets Database Construction
The 29 active components of AS were collected through the HERB database
([123]Supplementary Table 3), and 26 active compounds were obtained by
setting DL ≥ 0.18 in Swiss ADME ([124]Table 2). According to the active
components, we obtained 556 targets by using the Swiss Target
Prediction database after removing the duplicates ([125]Supplementary
Table 1).
Table 2.
Information of bioactive components of AS.
Ingredient ID CAS Ingredient name DL
HBIN003737 1981-81-3 Hydroxyhopanone 0.55
HBIN004383 67392-96-5 Stigmast-4-en-3-one 0.55
HBIN007288 149-91-7 Gallic acid 0.56
HBIN008266 2034-74-4 3-Hydroxystigmast-5-en-7-one 0.55
HBIN012810 36450-02-9 (6beta,24R)-6-Hydroxystigmast-4-en-3-one 0.55
HBIN015955 559-70-6 Amyrin 0.55
HBIN018278 83-46-5 beta-Sitosterol 0.55
HBIN023517 514-07-8 Taraxerone 0.55
HBIN025629 169567 Erybidine 0.55
HBIN025688 5317205 Erythraline 0.55
HBIN025690 442220 Erythratidine 0.55
HBIN025796 305-01-1 Esculetin 0.55
HBIN029763 34427-61-7 Hydroxysitosterol 0.55
HBIN029818 487-58-1 Hypaphorine 0.55
HBIN029831 9065764 Hyperin 0.55
HBIN031753 520-18-3 Kaempferol 0.55
HBIN035817 69-65-8 Mannitol 0.55
HBIN041495 117-39-5 Quercetin 0.55
HBIN044152 474-58-8 Sitogluside 0.55
HBIN044849 113626-76-9 Stigmast-4-ene-3,6a-diol 0.55
HBIN044850 23670-94-2 Stigmast-4-ene-3,6-dione 0.55
HBIN044913 22149-69-5 Stigmastane-3,6-dione 0.55
HBIN046124 14167-59-0 Tetratriacontane 0.55
HBIN047613 77-52-1 Ursolic acid 0.85
HBIN047744 121-33-5 Vanillin 0.55
HBIN048051 14985 Vitamin E 0.55
[126]Open in a new tab
Common Target Genes of Drugs and Diseases Database Construction
The 998 potential targets were found in Genecards database after using
“anti-oxidant” as a keyword to search. The targets of the active
components of AS were intersected with the antioxidant targets, and
then we obtained 152 targets related to the antioxidant effect of AS.
Construction of Protein-Protein Interaction Network and Screening of Core
Targets
The 152 intersection targets were imported into the String database to
obtain the PPI relationship, and the PPI network was constructed on
medium confidence interaction score (0.4) ([127]Figure 6). The size and
color of the nodes were adjusted according to the degree value. As the
degree value increased, the nodes got bigger, and the color got darker
([128]Supplementary Table 2). PPI network analysis results confirmed
that the highest combined node score was 0.999 and the lowest combined
score was 0.4 ([129]Supplementary Table 11). The top 14 key target
proteins were screened according to the degree value, and the results
are shown in [130]Table 3.
Figure 6.
[131]Figure 6
[132]Open in a new tab
Antioxidant targets of AS interaction network.
Table 3.
Key targets of AS antioxidant PPI network.
Number Target Degree Number Target Degree
1 Threonine kinase1 (AKT1) 106 2 Interleukin 6 (IL-6) 87
3 Mitogen-activated protein kinase 3 (MAPK3) 81 4 Mitogen-activated
protein kinase 1 (MAPK1) 79
5 Tumor necrosis factor (TNF) 78 6 Epidermal growth factor receptor
(EGFR) 73
7 SRC proto-oncogene (SRC) 70 8 Signal transducer and activator of
transcription 3 (STAT3) 66
9 Mitogen-activated protein kinase 8 (MAPK8) 66 10 C-X-C motif
chemokine ligand 8 (CXCL8) 64
11 Sirtuin-1 (SIRT1) 64 12 Prostaglandin-endoperoxide synthase 2
(PTGS2) 64
13 Mechanistic target of rapamycin kinase (MTOR) 59 14 Strogen receptor
1 (ESR1) 58
[133]Open in a new tab
GO Analysis and KEGG Enrichment Analysis of Core Target Gene
We performed GO enrichment analysis and KEGG pathway annotation
analysis on 152 intersection targets. GO analysis resulted in 2,837 GO
entries (P < 0. 05), 2,544 items for biological process (BP), 114 items
for cell component (CC), and 179 items for molecular function (MF)
([134]Supplementary Data Sheet 1). Among these categories, most targets
were enriched in the biological process. Within the biological process
category, reactive oxygen species biosynthetic process and response to
molecules of bacterial origin were the most dominant subcategories.
About the molecular function category, the most targets were assigned
to nuclear receptor binding, protein N-terminus binding, hormone
receptor binding, and drug binding. As for the cellular components
category, the four most abundant sub-categories were inclusion body,
vesicle lumen, plasma membrane raft, and phagocytic cup ([135]Figure
7).
Figure 7.
[136]Figure 7
[137]Open in a new tab
Histogram of GO enrichment analysis of antioxidant targets in AS.
We used KEGG analysis to analyze the regulatory pathways of the targets
and obtained 212 signaling pathways (p < 0.05) ([138]Supplementary
Table 6). [139]Figure 8 shows the top 15 potential signal pathways of
the targets. The KEGG pathways in which most targets were enriched were
pathways in cancer, proteoglycans in cancer, PI3K-AKT signaling
pathway, and FoxO signaling pathway. Moreover, the oxidative stress
related pathways were PI3K-AKT signaling pathway and FoxO signaling
pathway. A total of 20 target genes including AKT1, SIRT1, and MAPK1
were involved in the FoxO pathway, and 25 target genes including AKT1,
MTOR, and MAPK1 were involved in the PI3K/AKT pathway. We selected the
top 4 antioxidant effect related genes (MTOR, AKT1, SIRT1, and MAPK1)
belonging to these pathways to further confirmation under qPCR
experiment.
Figure 8.
[140]Figure 8
[141]Open in a new tab
Bubble chart of KEGG pathway enrichment analysis of antioxidant targets
in AS.
The forkhead box O (FoxO) family of transcription factors regulates the
expression of genes in cellular physiological events including
apoptosis, cell-cycle control, glucose metabolism, oxidative stress
resistance, and longevity ([142]42). A central regulatory mechanism of
FoxO proteins is phosphorylation by the serine-threonine kinase
AKT/protein kinase B (AKT/PKB), downstream of phosphatidylinositol
3-kinase (PI3K), in response to insulin or several growth factors
([143]43). Studies have shown that FoxO1 can reduce oxidative stress
injury by regulating downstream target genes, such as Mn-superoxide
dismutase (Mn-SOD) and catalase (CAT), to remove excess ROS ([144]44).
Phosphatidylinositol-3-kinase/proteinkinase B (PI3K/ AKT) signaling
pathway is an important pathway for intracellular transduction of
membrane receptor signals. It regulates cardiovascular function through
various mechanisms such as vascular endothelial cell migration,
angiogenesis, and energy metabolism, and is closely related to
oxidative stress and inflammatory response ([145]45). Previous studies
have confirmed that some important signal transduction pathways, such
as PI3K-AKT signaling pathway, deal with the oxidative damage to cells
by participating in ROS activation of Nrf2 ([146]46). Therefore, we
supposed AS exerts antioxidant effect mainly through affecting FoxO and
PI3K/AKT signaling pathway.
The Expression Level of AS-Antioxidant-Related Genes
To explore the molecular mechanism of AS in the treatment of oxidative
stress, we selected AKT1, MTOR, MAPK1, and SIRT1 to verify the
expression level changes by qRT-PCR. These genes were selected based on
the result of KEGG analysis. After 4 h of H[2]O[2] treatment, we
detected the expression levels of these four target genes. As exhibited
in [147]Figure 9, the expression levels of AKT1 in the low-dose and
medium-dose groups were significantly up-regulated compared with the
positive control group (p < 0.05). MAPK1 gene expression levels
increased significantly in all AS treatment groups (p < 0.05), the
expression levels of MTOR in the medium- and high-dose groups were
significantly up-regulated (p < 0.05). SIRT1 expression was
significantly up-regulated in the medium-dose group (p < 0.05).
Figure 9.
[148]Figure 9
[149]Open in a new tab
The expression level of core genes. (A) The expression level of AKT1
mRNA. (B) The expression level of MAPK1 mRNA. (C) The expression level
of SIRT1 mRNA. (D) The expression level of MTOR mRNA. The results were
expressed as the mean ± SE of three independent experiments. *P < 0.05
vs. 0, **P < 0.01 vs. 0. ^#P < 0.05 vs. H[2]O[2], ^##P < 0.01 vs.
H[2]O[2], ANOVA analyses ([150]Supplementary Table 10).
Sirtuin-1 (SIRT1) is a conserved, nicotinamide adenine dinucleotide
(NAD+)-dependent III histone deacetylase ([151]47). Immense amounts of
studies have shown that SIRT1 plays an important role in oxidative
stress injury by regulating various target genes and proteins such as
NF-κB, FoxO1, P53, and Nrf2 ([152]48–[153]51). SIRT1 can activate FoxO1
through deacetylation and alleviate oxidative stress injury caused by
H[2]O[2] ([154]49). AKT1 is a downstream molecule of SIRT1, which has a
significant influence on the regulation of cell proliferation, cell
survival, and protein synthesis ([155]52). Zhai et al. ([156]53) have
proved that overexpressed SIRT1 increases the phosphorylation levels of
PI3K and AKT, thereby inhibiting the apoptosis of cardiomyocytes
induced by high glucose and reducing its oxidative stress response.
MTOR is an important downstream target of AKT and takes part in the
expression and transcription of related proteins and genes, thus
affecting biological activities such as inflammation, oxidative stress,
apoptosis, and so on ([157]54, [158]55). The over-expressed SIRT1
activates PI3K through tyrosine kinase receptor, then the activated
PI3K promotes the phosphorylation of AKT, activates MTOR, and inhibits
oxidative stress and inflammation ([159]56). These studies have
revealed that over-expressed SIRT1 activates MTOR and AKT1 and reduces
oxidative stress injury. This is consistent with the fact that AS can
up-regulate the expression levels of SIRT1, MTOR, and AKT1 in this
experiment. MAPK signaling pathway is an important pathway that
controls many basic cellular processes such as cell proliferation,
oxidative stress, survival, and apoptosis ([160]57). Therefore, MAPK1
may play an important role in the regulation of oxidative stress in
cells.
The results showed the expression levels of AKT1, MAPK1, SIRT1, and
MTOR in the model group were significantly up-regulated compared with
the normal group (p < 0.05). After AS treatment, the expression levels
of these four target genes were increased again compared with the
H[2]O[2] group. We speculated that after a short period of oxidative
stress, the cell's antioxidant mechanism will be activated by excessive
ROS, that is alleviating the oxidative damage of cells through
self-regulation and compensatory up-regulate these four genes. In this
study, PI3K-AKT and FoxO signaling pathway were the key signaling
pathways obtained from KEGG pathway enrichment analysis. What is more,
AKT1, SIRT1, and MAPK1 could regulate the FoxO signaling pathway, while
AKT1, MTOR, and MAPK1 can regulate the PI3K/AKT signaling pathway. The
mechanism of how AS exerts its antioxidant effect we predicted was
shown in [161]Figure 10.
Figure 10.
[162]Figure 10
[163]Open in a new tab
How AS exerts antioxidant effects.
These results suggested that FoxO and PI3K-AKT signaling pathways might
be the key pathways for AS to exert antioxidant effects. This
prediction result is consistent with the fact that AS can up-regulate
the expression of these four target genes. In conclusion, AS mitigates
oxidative damage that may be attributed to it regulating FoxO and
PI3K-AKT signaling pathways by up-regulating AKT1, SIRT1, MTOR, and
MAPK1.
Conclusions
The present study investigated the in vitro and intracellular
antioxidant activity of AS, and the potential antioxidant mechanism
based on network pharmacology. In in vitro studies, AS revealed the
strong reducing power and DPPH scavenging effect, but hydroxyl radical
scavenging activity and ferrous ions-chelating ability were not strong.
The intracellular studies of RAW264.7 cells presented pretreatment with
AS significantly improved the antioxidant status of cells. AS showed
significant protective effect on the viability of H[2]O[2]-treated
cells, increased the activities of SOD, CAT, and GSH-Px, and decreased
the MDA level. We used network pharmacology analysis to select core
targets (MTOR, AKT1, SIRT1, and MAPK1) belonging to FoxO and PI3K/AKT
signaling pathway to further confirmation. AS preconditioning could
significantly up-regulate the expression level of AKT1, SIRT1, MAPK1,
and MTOR in model cells, and the effect was related to the regulation
of FoxO and PI3K/AKT signaling pathway. It can be inferred that the
accuracy of this network pharmacology study is high and worth further
study.
Data Availability Statement
The original contributions presented in the study are included in the
article/[164]Supplementary Material, further inquiries can be directed
to the corresponding author.
Author Contributions
Y-nM: writing-original draft, visualization, data curation, formal
analysis, and investigation. FC: conceptualization, methodology,
software, and writing-review and editing. ZY: writing-review and
editing, investigation, and resources. X-fS: writing-review and editing
and conceptualization. J-pL, H-jZ, AW, and C-fL: funding acquisition.
R-fS and B-cH: supervision and funding acquisition. X-hW: supervision.
YL: funding acquisition, resources, writing-review and editing, and
project administration. All authors contributed to the article and
approved the submitted version.
Funding
This work was supported by Agricultural Science and Technology
Innovation Program (No. 25-LZIHPS-03), Lanzhou Science and Technology
Planning Project (No. 2018-1-114), and Xinjiang Uygur Autonomous Region
“Tianchi Doctoral Project” (No. E1954101).
Conflict of Interest
The authors declare that the research was conducted in the absence of
any commercial or financial relationships that could be construed as a
potential conflict of interest.
Publisher's Note
All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their affiliated
organizations, or those of the publisher, the editors and the
reviewers. Any product that may be evaluated in this article, or claim
that may be made by its manufacturer, is not guaranteed or endorsed by
the publisher.
Supplementary Material
The Supplementary Material for this article can be found online at:
[165]https://www.frontiersin.org/articles/10.3389/fvets.2021.784898/ful
l#supplementary-material
[166]Click here for additional data file.^ (30.8KB, XLSX)
[167]Click here for additional data file.^ (11.3KB, XLSX)
[168]Click here for additional data file.^ (12.7KB, XLSX)
[169]Click here for additional data file.^ (13.9KB, XLSX)
[170]Click here for additional data file.^ (15.6KB, XLSX)
[171]Click here for additional data file.^ (25.3KB, XLSX)
[172]Click here for additional data file.^ (10.1KB, XLSX)
[173]Click here for additional data file.^ (10.2KB, XLSX)
[174]Click here for additional data file.^ (10.2KB, XLSX)
[175]Click here for additional data file.^ (15.8KB, XLSX)
[176]Click here for additional data file.^ (669.2KB, XLSX)
[177]Click here for additional data file.^ (557.2KB, CSV)
References