Abstract
The porcine reproductive and respiratory syndrome virus (PRRSV),
especially the highly pathogenic strains, can cause serious acute lung
injury (ALI), characterized by extensive hemorrhage, inflammatory cells
and serous fluid infiltration in the lung vascular system. Meanwhile,
the pulmonary microvascular endothelial cells (PMVECs) are essential
for forming the air–blood barrier and keeping the water–salt balance to
prevent leakage of circulating nutrients, solutes, and fluid into the
underlying tissues. As well, they tightly regulate the influx of immune
cells. To determine the possible relationship between the PMVECs’
function changes and lung vascular permeability during PRRSV infection,
the PMVECs were co-cultured with HP-PRRSV-inoculated primary pulmonary
alveolar macrophages (PAMs) in transwell model, and then the RNA
sequencing (RNA-seq) and comprehensive bioinformatics analysis were
carried out to characterize the dynamic transcriptome landscapes of
PMVECs. In total, 16,489 annotated genes were identified, with 275
upregulated and 270 downregulated differentially expressed genes (DEGs)
were characterized at both 18 and 24 h post PRRSV inoculation. The GO
terms and KEGG pathways analysis indicated that the immune response,
metabolic pathways, cell death, cytokine–cytokine receptor interaction,
viral responses, and apoptotic process are significantly regulated upon
co-culture with PRRSV-infected PAMs. Moreover, according to the TERR
and dextran flux assay results, dysregulation of TJ proteins, including
CLDN1, CLDN4, CLDN8, and OCLN, is further confirmed to correlate with
the increased permeability of PMVECs. These transcriptome profiles and
DEGs will provide valuable clues for further exploring the roles of
PMVECs in PRRSV-induced ALI in the future.
Keywords: porcine reproductive and respiratory syndrome virus (PRRSV),
pulmonary microvascular endothelial cells (PMVECs), transcriptome
analysis, transwell co-cultures, cytokines, tight junctions (TJs)
1. Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV) is
classified into the genus Betaarterivirus, family Atreriviridae, and
order Nidovirales [[40]1]. It is the pathogen of the porcine
reproductive and respiratory syndrome (PRRS), which is characterized by
severe reproductive failure in sows, respiratory disorder, reduction in
growth rate, and increased mortality in the outbreak herd. Since the
first report in the late 1980s [[41]2,[42]3,[43]4,[44]5], PRRS has
become one of the most economically important swine diseases that
seriously hinders the development of the pork industry worldwide.
Especially, some “atypical” highly pathogenic strains, causing extended
severity and ranges of clinical signs, periodically emerge in Asia,
East Europe, and America. Notably, the highly pathogenic PRRS
(HP-PRRS), known as “porcine high fever diseases”, associated with high
body temperature (as high as 42 °C), high mobility, high mortality, and
devastating economic loss, emerged in China in 2006 and spread in
several Southeast Asian countries in the following years
[[45]6,[46]7,[47]8,[48]9]. Similarly, another highly pathogenic
variant, Lineage 1C strain, typed as 1-4-4 pattern of restriction
fragment length polymorphism (RFLP) for its open reading frame 5 (ORF5)
gene, has been recently reported in many midwestern states of the
United States. During the outbreak, the herds show increased
farrow-to-finish mortality, abortions, mummies, and slower growth in
finishing pigs [[49]10]. The epidemic of these variant strains has
greatly reformed the understanding of pathogenicity and the economic
impact of PRRSV.
PRRSV can cause interstitial pneumonia in all ages of pigs, with varied
severity and distribution as the difference of viral virulence, host
susceptibility, and host immune status. Among the PRRSV-induced
microscopic lesions, it is consistently observed that the alveolar
septa are expanded by macrophages, lymphocytes, and plasma cells; as
well, the alveoli are filled with necrotic macrophages, cell debris,
and fluid. For HP-PRRSV infection, acute lung injury (ALI) is widely
observed, which is characterized by aberrant immune responses,
involving extensive hemorrhage and infiltration of inflammatory cells
and serous fluid in the lung vascular system [[50]11]. These severe
lesions might contribute to the increased mortality of HP-PRRS.
However, the underlying mechanisms of ALI caused by HP-PRRSV remain
unclear, such as how the virus infection induces the circulating
inflammatory cells and erythrocytes, as well as fluid flux into the
sub-endothelial space.
Together with basement membrane and perivascular cells, the endothelial
cells in the medial surfaces of blood vessels constitute an intact
vascular barrier [[51]12]. The primary function of the vascular barrier
is to prevent leakage of circulating nutrients, solutes, and fluid into
the underlying tissues. As well, it can tightly regulate the influx of
immune cells [[52]13]. Intercellular junctions among the adjacent
endothelial cells provide blood and lymph vessel integrity, and they
are essential for the formation of a vascular system, which controls
the paracellular movement of the substances above and through the
endothelium [[53]12]. Altered endothelial junctions can lead to barrier
dysfunction and have been implicated in several kinds of diseases, such
as severe infections, cancer, and aggressive inflammatory responses
[[54]14]. One devastating manifestation of the disassembly of
endothelial junctions is observed in ALI. The excessive immune response
triggers the disruption of the lung endothelial barrier, and fluid and
protein leak out of the lung capillaries and flux into the alveolar
space, causing lung edema. Then, the fluid impairs gas exchange across
the air–blood barrier and compromises respiratory function
[[55]15,[56]16]. Various transmembrane adhesion proteins are located at
the adherents and tight junctions, to connect adjacent endothelial
cells and to sustain the endothelial barrier integrity through
homophilic interactions [[57]17]. On the intracellular side, adhesion
proteins cytoplasmic tails interact with actin cytoskeleton and
adherents or tight junction-associated proteins, including β-catenin,
α-catenin, zona occludens 1 (ZO-1) and 2 (ZO-2), and others to
stabilize the junctions [[58]12,[59]17,[60]18]. Considering the pivotal
roles of endothelial junctions on barrier integrity, we wonder whether
these proteins in endothelial cells are regulated when PRRSV induces
the ALI.
In addition to maintaining endothelial barrier integrity, the
endothelial cells are also important for inflammatory responses
[[61]19,[62]20]. During lipopolysaccharide (LPS) stimulation, virus
infection, inflammation, and tissue injury, endothelial cells can
secrete a high level of chemokines and cytokines, such as tumor
necrosis factor α (TNF-α) and interleukin-1 (IL-1). Meanwhile, on the
surface of vascular endothelial cells, the leukocyte adhesion
molecules, particularly the vascular cell adhesion molecule-1 (VCAM-1)
and intercellular adhesion molecule 1 (ICAM-1), are upregulated,
aggravating inflammation and promoting monocyte extravasation from
vessels into perivascular tissues [[63]21,[64]22,[65]23,[66]24]. As the
primary target cells of PRRSV, PAMs can secrete abundant cytokines and
chemokines in the course of infection, such as IL-1, TNF-α, and RANTES
[[67]25,[68]26]. Thus, the PRRSV-Infected PAMs might interact with
PMVECs to impair the air–blood barrier; however, the role of PMVECs in
PRRSV-induced ALI is less known.
In the present study, the role of PMVECs on the PRRSV-induced ALI is
investigated by establishing PMVECs and PAMs transwell co-culture
system and using RNA-seq analysis. The results initially provided an
overall transcriptome landscape of PMVECs that interact with HP-PRRSV
strain JXwn06-infected PAMs, and the deeper analyses further
demonstrate that the interaction can dysregulate the tight junction
(TJ) proteins and facilitate chemokines as well as leukocyte adhesion
molecule production in PMVECs. These results provide important insights
into the mechanisms of lung vascular permeability changes during PRRSV
infection.
2. Materials and Methods
2.1. Ethical Statements
The animal experiments in this study were carried out according to the
Chinese Regulations of Laboratory Animals: The Guidelines for the Care
of Laboratory Animals (Ministry of Science and Technology of the
People’s Republic of China, Beijing, China) and Laboratory Animal
Requirements of Environment and Housing Facilities (National Laboratory
Animal Standardization Technical Committee). The protocol for primary
PAMs preparation was approved by the Laboratory Animal Ethical
Committee of CAU, with approval no. AW81801202-2-1.
2.2. Cells and Virus
Primary PAMs were prepared from 4-week-old specific-pathogen-free (SPF)
landrace pigs, as previously described [[69]4,[70]27,[71]28]. The pigs
were purchased from the Beijing Center for SPF Swine Breeding and
Management that is free from PRRSV, African swine fever virus (ASFV),
porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV),
pseudorabies virus, swine influenza virus, and Mycoplasma hyopneumoniae
infection. Briefly, the lavage fluid was collected from the lungs of
euthanized pigs and washed about ten times with PBS supplemented with
2% fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA). The cell
pellets were resuspended and mixed with prechilled GIBCO RPMI-1640
medium (Thermo Fisher, Waltham, MA, USA) containing 40% FBS. The number
of the prepared PAMs reached 10^8–10^9 /mL with >95% viability.
Aliquots of PAMs were frozen and stored in liquid nitrogen before use.
The viability of PAMs was determined to be 85–90% by trypan blue dye
exclusion. PAMs were maintained in GIBCO PRMI-1640 medium, with 10%
FBS, 100 mg/mL kanamycin, 50 U/mL penicillin, 50 mg/mL streptomycin, 25
mg/mL polymyxin B, and 1 mg/mL fungizone at 37 °C under a humid 5%
CO[2]atmosphere. The immortalized endothelial cell line PMVEC (YaJi
Biological, YS1234C, Shanghai, China) was cultured in RPMI-1640 medium
supplemented with 5% FBS at 37 °C under a humid 5% CO[2] atmosphere.
The HP-PRRSV strain JXwn06 (GenBank accession number [72]EF641008) at
the 8th passage was used in this study [[73]9].
2.3. Transwell Co-Cultures System
A total of 2.5 × 10^5 PMVECs was seeded into transwell inserts with 24
mm diameter, 0.4 µm pore size (Corning Inc., Corning, NY, USA), and was
allowed to grow in RPMI-1640 medium supplemented with 5% FBS to
confluence. Primary PAMs were plated into the basolateral chamber about
12 h before PMVECs became confluent. Upon the PMVEC monolayer growing
to confluence, the PAMs were inoculated with HP-PRRSV strain JXwn06 at
a multiplicity of infection (MOI) of 5 or treated with RPMI-1640 medium
as mock-infection. After 1 h incubation, the virus inoculum was
carefully removed, and the cells were washed with PBS and further
maintained in RPMI-1640 medium containing 2% FBS. At 18 and 24 h post
infection (hpi), the supernatant was discarded, and the PMVECs in both
groups were immediately harvested for RNA extraction by using TRIzol
(Life Technologies, Carlsbad, CA, USA) and RNA-seq for transcriptomic
analysis.
2.4. Transcriptome mRNA Library Construction and Sequencing
Total RNA was extracted from PMVECs in different groups using TRIzol
reagent, following the manufacturer’s procedure. RNA library
construction and sequencing were performed by LC Bio (Zhejiang, China).
Briefly, the total RNA quantity and purity were analyzed by Bioanalyzer
2100 and RNA 1000 Nano LabChip Kit (Agilent, Santa Clara, CA, USA) with
RIN number > 7.0. Poly(A) RNA is purified from total RNA (5 µg) using
poly-T oligo-attached magnetic beads with two rounds of purification.
After purification, the mRNA is fragmented into small pieces using
divalent cations under elevated temperatures. Then, the cleaved RNA
fragments were reverse-transcribed to create the final cDNA library
following the protocol for the mRNA-Seq sample preparation kit
(Illumina, San Diego, CA, USA). The average size of insert for the
paired-end libraries was 300 bp (±50 bp). Then, the paired-end
sequencing was performed on an Illumina Hiseq4000 (LC Sciences,
Houston, TX, USA) following the vendor’s recommended protocol. The raw
sequencing data (raw reads) were preserved in FASTQ format. Clean reads
were obtained by removing the adaptors, reads of the unknown base with
more than 10%, and those with low quality from the raw reads. The
acquired reads were then aligned to the Sus scrofa genome assembly (Sus
scrofa 10.2) using TopHat2 [[74]29]. The mapped reads of each sample
were assembled by using StringTie. Then, all transcriptomes from
samples were merged to reconstruct a comprehensive transcriptome using
Perl scripts. After the final transcriptome was generated, StringTie
and edgeR were used to estimate the expression levels of all
transcripts by calculating fragments per kilobase of exon model per
million mapped (FPKM) reads. The differentially expressed mRNAs and
genes were selected with log2 (fold change) > 1 or log2 (fold change) <
−1 and with statistical significance (p value < 0.05) by the R package.
2.5. Venn, GO and KEGG Pathway Enrichment Analysis
Venn analysis, GO enrichment, and KEGG enrichment analysis were
performed as described by LC Bio ([75]https://www.lc-bio.cn/, accessed
on 11 January 2022).
2.6. Quantitative Reverse Transcription PCR (RT-qPCR)
PMVECs were collected from the co-culture system at 18 and 24 hpi, and
the total RNAs were extracted by using TRIzol following the
manufacturer’s instructions. Then, 1 µg of RNAs was used for further
reverse transcription utilizing the FastKing RT Kit (with gDNase)
(TIANGEN, KR116, Beijing, China). Quantitative PCR (qPCR) was performed
by using Bio-Rad CFX96 Touch Real-Time PCR cycler (Bio-Rad, Hercules,
CA, USA) with primers listed in [76]Table 1 and SYBR green detection,
with the thermal protocol: 50 °C for 5 min; 95 °C for 2 min; followed
by 40 cycles of 95 °C for 10 s and 60 °C for 50 s. Data collection was
performed at the step of 60 °C annealing/elongation. Relative
quantification of target genes was performed using the 2^−ΔΔCt method
with β-actin as a housekeeping gene.
Table 1.
List of primers used in this study.
Names * Primer Sequence (5′-3′)
β-actin-F ACCACCATGTACCCAGGCAT
β-actin-R GGACTCGTCGTACTCCTGCT
CCL20-F AAGCAACTTTGACTGCTGCC
CCL20-R GGATCTGCACACACGGCTAA
STAT1-F CCATTGGTCCTGAAGACTGGAG
STAT1-R TTCGTGTGAGTGCCCAAAATG
CLDN1-F CCGTGCCTTGATGGTAATTG
CLDN1-R ACCATGCTGTGGCAACTAAG
CLDN4-F TGGATGATGAGAGCGCCAAG
CLDN4-R GGGATTGTAGAAGTCGCGGA
CLDN8-F TGGTGGTGTTGGAATGGTGG
CLDN8-R GTTGCTTCCAATGAAGGCGG
OCLN-F GCTGGAGGAAGACTGGAT
OCLN-R ATCCGCAGATCCCTTAAC
[77]Open in a new tab
* F represents forward PCR primer; R represents reverse PCR primer.
2.7. Western Blot
Extraction of total proteins from treated PMVECs was performed with
RIPA lysis buffer (Beyotime, P0013B, Shanghai, China) supplemented with
1 mM PMSF (Beyotime, ST506, Shanghai, China) on ice. Protein
concentrations were measured with an enhanced BCA protein assay kit
(Beyotime, P0010S, Shanghai, China). Then, 20 ug proteins per sample
was mixed with 5 × loading buffer and boiled at 70 °C for 15 min, and
they were separated by SDS-PAGE. After transferring the proteins onto a
polyvinylidene difluoride membranes (PVDF, Millipore, IPVH07850,
Darmstadt, Germany), the membrane was blocked in phosphate-buffered
saline (PBS) with 5% skimmed milk at room temperature for 2 h, followed
by incubation at 4 °C overnight with primary antibodies and then
horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit
secondary antibodies at room temperature for 1 h while shaking. The
protein bands were detected by the ECL Western blotting system (Thermo
Fisher, Waltham, MA, USA). The following primary antibodies were used:
anti-CLDN1 (1:2000, Proteintech, 13050-1-AP, Rosemont, IL, USA),
anti-CLDN4 (1:1000, Abcam, ab53156, Cambridge, UK), anti-CLDN8 (1:1000,
Novus Biologicals, NBP1-59157, Littleton, CO, USA), anti-OCLN (1:1000,
CUSABIO, CSB-PA016263LA01HU, Hubei, China), and anti-ACTB (1:5000,
CUSABIO, CSB-MA000091M0m, Hubei, China).
2.8. Trans-Endothelial Electrical Resistance and In Vitro Vascular
Permeability Assay
The integrity of the PMVECs monolayer was first evaluated by measuring
trans-endothelial electrical resistance (TEER). In transwell cultures,
TEER was measured by using an Epithelial Volt Ohm Meter (EVOM) with
“chopstick” electrodes (Beijing Kingtech Technology, RE1600, Beijing,
China) as previously described [[78]30]. Inserts with medium alone were
used for blank resistance measurements. TEER values (Ω·cm^2) of PMVEC
monolayer at different time points were measured and calculated
according to the following formula:
[MATH:
TEER=(Ωendothelial cells−Ωmedium alone)×cell culture surface
area :MATH]
To evaluate the integrity of the PMVEC barrier post virus infection in
vitro, the TEER and vascular permeability assay were both performed.
First, pulmonary microvascular endothelial cells were grown until TEER
values ranged between 15 and 18 (Ω·cm^2), indicating 100% cell
confluency. Then, the primary PAMs plated in the basolateral chamber
were inoculated with JXwn06 or mock at an MOI of 5. At sequential 12 h
time points post inoculation, the TEER values, expressed in Ohms (Ω),
were tested by using EVOM. Endothelial permeability was expressed as
relative TEER, which represents a ratio of resistance values (Ω) as
follows:
[MATH:
Relative TEER=<
/mo>Ωexpreimental condition−Ωmedium aloneΩnon−tr
eated endothelial cells
−Ωmedium alone×100% :MATH]
At the same time, transwell inserts were transferred to another 12-well
plate supplemented with 1.5 mL Hank’s balanced salt solution (HBSS),
and then 0.5 mL 40 kDa dextran conjugated to FITC (Sigma Aldrich, St.
Louis, MO, USA) was added to the apical chamber of the transwell
inserts at a final concentration of 1 mg/mL and incubated for 2 h at 37
°C. Then, the transwell inserts were removed, and 100 µL supernatant
from each well was collected from triplicate wells and transferred to a
96-well flat-bottom plate. Fluorescence was measured on a plate reader,
and the concentration of dextran–FITC that passed from the apical to
the basolateral chamber was determined by using the standard curve
(3.125–50 µg/mL). The PMVECs monolayers in the mock-infected group were
used as baseline control.
2.9. Statistical Analysis
The data from RT-qPCR, RNA-seq, TEER as well as in vitro vascular
permeability assay were shown as means ± standard deviations (SD). The
GraphPad Prism software (version 5.0) was used to determine the
significance of the variability among different groups by a two-way
ANOVA test of variance. A p value < 0.05 was considered to be
statistically significant.
3. Results
3.1. Establishment of PMVECs and PAMs Transwell Co-Cultures In Vitro
To investigate the functional changes of PMVECs during PRRSV infection,
a transwell co-culture system with PAMs was set to mimic the
endothelial barrier in vitro. PMVECs were seeded on the apical chamber
of transwell inserts, and the integrity of the monolayer was evaluated
by measuring TEER at different time points after cells were plated
([79]Figure 1A), which was regarded as the standard parameter to
quantify the tightness of the endothelial barrier [[80]30,[81]31]. As
shown in [82]Figure 1B, the TEER of PMVECs monolayer rose continuously
during 12–36 h post-seeding, followed by a plateau lasting for an
additional 24 h with the TEER values around 15 to 18 Ω·cm^2, indicating
100% cell confluency. This was also verified by the FITC–Dextran
transwell assay in vitro (data not shown). These data suggest that the
PMVEC monolayer cultured in vitro can form a tight endothelial barrier
after 36 h post-seeding. Upon the PMVEC monolayer grown to confluence,
they were then co-cultured with primary PAMs ([83]Figure 1C)
Figure 1.
[84]Figure 1
[85]Open in a new tab
Schematic for PMVECs and primary PAMs transwell co-cultures and the
preparation of samples for RNA-seq. (A) PMVECs were plated onto
transwell semi-permeable membranes (0.4 μm pore size), and inserts with
medium alone were used for blank resistance measurements. A TEER assay
was used to evaluate the integrity of the PMVECs monolayer at indicated
time points over 60 h. (B) Relative TEER values from three independent
experiments performed in triplicate are plotted. The data are shown as
means ± SD (standard deviation). (C) Upon the PMVEC monolayer grown to
confluence, primary PAMs were infected with HP-PRRSV JXwn06 at an MOI
of 5 or treated with mock-infected. Total RNA of PMVECs was extracted
by using TRIzol reagent at different time points post viral infection
for RNA-seq analysis.
3.2. Differential Transcription Analysis of Genes in PMVECs in Response to
the Interaction with HP-PRRSV-Infected PAMs
To evaluate the effects of HP-PRRSV-infected PAMs on the endothelial
barrier, the macrophages were inoculated with HP-PRRSV strain JXwn06 at
an MOI of 5 to analyze how they modulate endothelial barrier integrity
([86]Figure 1C). Total RNA of PMVECs was extracted by using TRIzol
Reagent at 18 and 24 hpi respectively, followed by RNA-seq to detect
the mRNA transcription profiles in two groups (JXwn06-infected group
vs. mock-infected group) ([87]Figure 1C right).
The transcriptome analysis results showed that 16,489 genes were
identified in total. In comparison with the mock-infected group, there
were 340 upregulated genes and 354 downregulated genes in the
inoculation group at 18 hpi ([88]Figure 2A), which increased to 409 and
469 genes at 24 hpi ([89]Figure 2B), according to the statistical
criteria of log2 (fold change) > 1 or log2 (fold change) < −1 and
statistical significance (p value < 0.05). Among them, there were 275
upregulated genes ([90]Figure 2C) as well as 270 downregulated genes
([91]Figure 2D) conserved at these two time points.
Figure 2.
[92]Figure 2
[93]Open in a new tab
Differentially expressed genes (DEGs) in PMVECs co-cultured with
HP-PRRSV strain JXwn06-infected PAMs. In RNA-seq analysis, three
independent experiments were repeated in each group. (A,B) Volcano map
of a distinguishable mRNA expression profiling in PMVECs after JXwn06
inoculation at 18 and 24 hpi, respectively. The differentially
expressed genes were selected with log2 (fold change) > 1 or log2 (fold
change) < −1 and with statistical significance (p value < 0.05) by R
package. (C,D) Veen analysis was performed to identified genes
co-regulated by JXwn06 at 18 hpi and 24 hpi, including 275
co-upregulated (C) and 270 co-downregulated (D) genes. Data were
extracted from RNA-seq results.
Among these conserved genes at the two time points, the most enriched
upregulated ones are mainly involved in positive regulation of cell
migration, including vascular cell adhesion molecule-1 (VCAM-1),
Claudin 4 (CLDN4), C-C motif chemokine ligand 20 (CCL20), CCL22, C-X3-C
motif chemokine ligand 1 (CX3CL1). Besides, several genes involved in
innate immune response were also upregulated in PMVECs, including
IL-1α, colony-stimulating factor 3 (CSF3), chemokine CCL20, and STAT1,
which have been previously reported to be involved in PRRSV-infected
PAMs as well [[94]26,[95]32,[96]33]. Meanwhile, several genes such as
hyaluronidase 3, gap junction protein beta 1, aquaporin 3, transferrin,
and CLDN8, involved in cell junctions, ion delivery, water, and
glycerol permeation, were found to be significantly downregulated at
about 74–94%, compared with that in the mock-infected group. Few
downregulated genes were related to immune response, which is different
from the transcriptome data of PAMs, showing great immune suppression
after PRRSV infection [[97]28].
3.3. Analysis of Gene Ontology (GO) Terms and Kyoto Encyclopedia of Genes and
Genomes (KEGG) Pathways of DEGs
As the gene dysregulation reflects the molecular phenotype of PMVECs
affected by the HP-PRRSV-infected PAMs, the GO terms and KEGG pathways
analysis were also carried out to further determine the functions of
DEGs in PMVECs. The basic functions of the top altered genes were
classified into three terms, including biological process, cellular
component, and molecular function ([98]Figure 3A,B). The biological
processes of enriched GO terms include regulation of transcription,
signal transduction, defense response to the virus, immune response,
and cell adhesion as well as positive or negative regulation of
apoptosis. For the cellular component, the membrane, integral component
of membrane, and cytoplasm were identified as the top three items for
the infection group. Most molecular functions identified were
classified into several “binding” activities. The major processes of
enriched GO terms were conserved between 18 and 24 hpi.
Figure 3.
[99]Figure 3
[100]Figure 3
[101]Figure 3
[102]Figure 3
[103]Open in a new tab
Gene Ontology (GO) terms and KEGG pathway enrichment of the DEGs. (A,B)
The most significant enriched GO terms (top 50) among the DEGs in the
JXwn06 inoculation group at 18 hpi vs. mock 18 hpi (A) and JXwn06
inoculation group at 24 hpi vs. mock 24 hpi (B). (C,D) The most
significant enriched KEGG pathways among the DEGs in the JXwn06
inoculation group at 18 hpi vs. mock 18 hpi (C) and JXwn06 inoculation
group at 24 hpi vs. mock 24 hpi (D).
The altered pathways associated with dysregulated genes in the
HP-PRRSV-infected group were further represented ([104]Figure 3C,D).
Cytokine–cytokine receptor interactions, NF-κB, Jak-STAT, and PI3K-Akt
signaling pathway, as well as monocyte adhesion and metabolism
pathways, were dysregulated upon interaction with HP-PRRSV-infected
PAMs. Collectively, the data suggest that the interaction majorly
regulated the cytokine activation, monocyte adhesion, NF-κB signaling
pathway, and cell adhesion pathways in PMVECs, which might be the
response to the cytokines secreted by PAMs.
3.4. Cell Adhesion Molecules and Pro-Inflammatory Cytokines Are Induced in
PMVECs upon the Interaction with HP-PRRSV-Infected PAMs
To evaluate the roles of PMVECs in HP-PRRSV-induced inflammatory
responses, a comprehensive analysis specifically on monocyte adhesion
pathways and pro-inflammatory cytokine induction was further performed.
Compared with the mock-infected group, the transcription of IL-1α,
CSF3, AMCF-II, CX3CL1, CCL20, and STAT1 genes ([105]Figure 4) in PMVECs
from the HP-PRRSV infection group were strongly upregulated, suggesting
that inflammatory responses were well induced upon the interaction with
HP-PRRSV-infected PAMs. Conversely, intercellular adhesion molecule-1
(ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were also
upregulated in the HP-PRRSV infection group, indicating that it may
facilitate monocyte adhesion and rolling along the vascular wall by
promoting adhesion molecule expression on the surface of PMVECs.
Figure 4.
[106]Figure 4
[107]Open in a new tab
Analysis of several DEGs associated with cytokine–cytokine receptor
interactions and chemokine signaling pathway. RNA-seq data in fragments
per kilobase million (FPKM) for (A) IL-1α, (B) CSF3, (C) AMCF-II, (D)
CX3CL1, (E) CCL20, and (F) STAT1 for comparison are presented. The data
are shown as means ± SD (standard deviation), n = 3 independent
experiments. Asterisks indicate statistical significance (***, p <
0.001).
Previous studies have reported that PRRSV infection induces
pro-inflammatory cytokine production, such as IL-6, IL-8, and TNF-α, by
activating the NF-κB signaling pathway [[108]33,[109]34]. In addition,
IL-1α was always higher in the lungs of PRRSV-inoculated animals, which
was correlated with the severity of pulmonary lesions [[110]26].
Although PMVECs are unsusceptible to PRRSV, our results convincingly
demonstrate that they are an important type of cell in inflammatory
responses during PRRSV infection, which exacerbate inflammatory injury
by secreting inflammatory cytokines into the lung microenvironment
[[111]19,[112]20].
In a previous inoculation study, severe histopathological lesions were
usually observed in the lungs of HP-PRRSV-infected pigs, including a
large number of inflammatory cell infiltration [[113]11]. For the
PMVECs, except for releasing pro-inflammatory cytokines and chemokines,
they can also display leukocyte adhesion molecules on the surface of
endothelial cells to initiate monocyte adhesion and rolling along the
vascular wall. Taken together, our results reveal that
HP-PRRSV-infected PAMs can interact with PMVECs and activate several
genes transcriptions mainly manifested as excessive inflammatory
responses and high levels of adhesion molecules, which might contribute
to the monocyte chemotaxis in PRRSV-induced lung lesions.
3.5. HP-PRRSV Triggers Endothelial Barrier Dysfunction In Vitro
It is known that the movement of leukocytes through the endothelium is
tightly regulated by the dynamic opening and closure of junctions
between the adjacent endothelial cells [[114]12]. Given that HP-PRRSV
infection results in a large number of inflammatory infiltration and
extensive hemorrhage [[115]11], it is speculated that endothelial
barrier integrity might be destroyed to promote leakage of circulating
immune cells and erythrocytes into the tissues. Next, the roles of
HP-PRRSV in the PMVEC barrier dysfunction were evaluated in the
co-culture system.
Here, a TEER assay was used to evaluate the ability of
HP-PRRSV-infected PAMs to trigger the endothelial barrier dysfunction
in PMVECs. The results show that the infection of HP-PRRSV in the
co-culture system triggers the hyperpermeability of PMVECs in vitro,
which was manifested by the dramatic decline in TEER values, as early
as 12 h post HP-PRRSV infection ([116]Figure 5A). The TEER values were
further confirmed in a solute flux assay using macromolecules at 40 kDa
dextran conjugated to FITC as a tracer in PMVEC monolayers ([117]Figure
5B). Taken together, the integrity of the pulmonary microvascular
endothelial barrier is compromised in vitro upon interacting with
HP-PRRSV-infected PAMs.
Figure 5.
[118]Figure 5
[119]Open in a new tab
JXwn06 triggers endothelial barrier dysfunction in vitro. PMVECs were
grown on transwell semi-permeable membranes (0.4 μm pore size) and
allowed to grow to confluence. Then, the primary PAMs plated in the
basolateral chamber were inoculated with JXwn06 at an MOI of 5, and
mock-infected groups were set as a negative control. The permeability
of the PMVEC monolayer was determined by TEER (A) and FITC–Dextran
transwell assay (B). The data are shown as means ± SD (standard
deviation), n = 3 independent experiments performed in triplicate.
Asterisks indicate statistical significance (ns, p > 0.05; **, p <
0.01; ***, p < 0.001).
3.6. HP-PRRSV Infection Dysregulates PMVEC Tight Junction Proteins In Vitro
The RNA-seq data showed that plenty of TJ members were dysregulated in
the group with HP-PRRSV-infected PAMs. As shown in [120]Figure 6A–D,
compared to mock-infected groups, Claudin 1 (CLDN1) and CLDN4 were
significantly upregulated, while CLDN8 and Occludin (OCLN) were
downregulated in the HP-PRRSV infection group. The expression levels of
these four TJ associated proteins were further determined by Western
blotting. As was expected, the expression levels of CLDN1, CLDN4,
CLDN8, and OCLN ([121]Figure 6E) at 24 and 36 hpi were conserved with
the transcription trend detected by RNA-seq. The expression levels of
these TJ proteins were accompanied by the hyperpermeability changes of
the PMVECs monolayer in vitro ([122]Figure 5A,B). Taken together, these
data suggest that the expression levels of TJ proteins in PMVECs are
dysregulated by interactions with HP-PRRSV-infected PAMs, and this
process is associated with the destruction of pulmonary microvascular
monolayer integrity, which further provides convenience for immune
cells flux.
Figure 6.
[123]Figure 6
[124]Open in a new tab
Interendothelial junction-associated genes in PMVECs are dysregulated
upon interaction with HP-PRRSV-infected PAMs. RNA-seq data in fragments
per kilobase million (FPKM) for four TJ genes, including CLDN1 (A),
CLDN4 (B), CLDN8 (C), and OCLN (D), for comparison are presented. (E)
Western blot analysis of CLDN1, CLDN4, CLDN8, and OCLN in co-cultured
PMVECs at the indicated time points post inoculation. β-actin served as
a loading control. The data are shown as means ± SD (standard
deviation), n = 3 independent experiments. Asterisks indicate
statistical significance (***, p < 0.001).
3.7. Experimental Validation of Selected Genes
To validate the accuracy of transcription level in RNA-seq, the mRNAs
of four upregulated genes, including CCL20, STAT1, Claudin 1(CLDN1),
and CLDN4, together with two downregulated genes CLDN8 and Occludin
(OCLN), were selected to confirm their transcription levels by RT-qPCR
with the primers listed in [125]Table 1. As shown in [126]Figure 7A–F,
the transcription levels of all four genes were significantly increased
compared with the mock-infected group, while those of CLDN8 and OCLN
were significantly decreased, with a similar trend with the FPKM value
in RNA-seq results.
Figure 7.
[127]Figure 7
[128]Open in a new tab
RT-qPCR validation of differentially expressed genes in PMVECs upon
interaction with HP-PRRSV-infected PAMs at different time points. Shown
are the transcription levels of four upregulated genes (A–D), and two
downregulated ones (E,F). The levels of these genes were normalized
against β-actin and then compared to the mock-infected group. The data
are shown as means ± SD (standard deviation), n = 3 independent
experiments performed in triplicate. Asterisks indicate statistical
significance (ns, p > 0.05; **, p < 0.01; ***, p < 0.001).
Therefore, these results demonstrate that, during PRRSV infection,
PMVECs function as the pro-inflammatory cells to release abundant
pro-inflammatory cytokines and chemokines; at the same time, they are
also conducive to the circulating erythrocytes, fluid, and immune cells
to flux into the tissues via upregulation of the cell adhesion
molecules on the surface of the microvascular wall, as well as
disassembling tight junctions.
4. Discussion
Clinically, compared with low pathogenic PRRSV (LP-PRRSV) strains,
HP-PRRSV infection can cause serious lung lesions, which are primarily
characterized by extensive hemorrhage, considerable inflammatory cell
infiltration, and pulmonary edema [[129]11], indicating the increased
capability of HP-PRRSV to destroy the air–blood barrier of the lungs.
The endothelial cells form a one-cell thick walled layer called the
endothelium, which functions as a blood vessel wall and maintains
vascular homeostasis. Together with pulmonary epithelium and
interstitium, the vascular endothelium constitutes the air–blood
barrier that maintains the water–salt balance. However, its functional
changes during PRRSV infection are less known. To explore some clues
for further study on the roles of PMVECs played in PRRSV-caused lung
lesions, the transcriptomic technology was initially carried out, as it
is a useful approach to analyze the profile of genome-wide gene
expression levels influenced by the investigated factors. It can
characterize the transcriptional activity of thousands of genes at once
to create a global picture of cell function [[130]35]. In a previous
study, endothelial cells have been confirmed to be unsusceptible to
PRRSV infection [[131]32]; as a result, the permeability factors
secreted by PRRSV-infected PAMs might be the signal for cross-talking
with the PMVECs in the endothelial barrier during the viral infection.
Thus, a co-culture system with both PMVECs and HP-PRRSV-infected PAMs
was set to characterize the dynamic transcriptome landscapes of PMVECs
by RNA-seq and comprehensive bioinformatics analysis. Generally, the
transcriptome sequencing data indicate that the immune response,
metabolic pathways, cell death, cytokine–cytokine receptor
interactions, viral responses, and apoptotic processes are
significantly regulated upon the interaction with PRRSV-infected PAMs.
These significantly regulated genes and enriched pathways are important
candidates for further investigation to explore the mechanism of acute
lung lesion caused by HP-PRRSV.
Among these pathways, pro-inflammatory cytokines and chemokines, such
as IL-1α, CSF3, CCL20, CCL22, and CX3CL2, as well as VCAM-1, are
transcriptionally upregulated upon co-culture with HP-PRRSV-infected
PAMs, which indicates that the interaction may also lead to excessive
inflammatory responses in PMVECs. PRRSV infection has been shown to
compromise the integrity of many physiological barriers, including the
air–blood barrier, blood–brain barrier, and placental barrier. This
process is primarily attributed to exacerbated host immune responses
that lead to hyperpermeability of endothelial cells located on the
surface of different types of vessels. The increased vascular
permeability and pulmonary edema are prominent features of ALI and
acute respiratory distress syndrome (ARDS), which are commonly assumed
to relate to the levels of critical soluble cytokines, such as vascular
endothelial growth factor (VEGF) and TNFα
[[132]36,[133]37,[134]38,[135]39]. PAMs secrete a broad range of
pro-inflammatory cytokines and chemokines upon PRRSV infection, which
are responsible for the severity of pulmonary pathology. Our
transcriptomic data further indicate that PMVECs might be important
cells in inflammatory responses during PRRSV infection. This is
consistent with a recent study that demonstrates that the supernatants
of PRRSV-infected primary PAMs can induce significant expression of
inflammatory cytokines in vascular endothelial cells [[136]32]. These
upregulated molecules in PMVECs further facilitate the
hyperpermeability of pulmonary microvascular endothelial cells,
influencing disease manifestations.
Besides, several genes of endothelium intercellular junctions were
significantly dysregulated in PMVECs, whose products might greatly
contribute to maintaining the functions of the endothelial barrier.
Degradation of the endothelial junctions has been associated with
disease severity in several viral diseases. For example, the expression
levels of intercellular junction proteins, including claudin-5,
occludin, and zonula occludens-1, are significantly decreased in rabies
virus-infected brain microvascular endothelial cells [[137]40].
However, the importance of vascular permeability and the role of
intercellular junctions in the pathogenesis of PRRSV are still less
reported.
To further explore the mechanism of endothelial leakage, the
relationship of vascular permeability and TJ protein expression was
also investigated. The TERR and dextran flux assay, two methods
reflecting the ability of different particles to cross the endothelium
by transcellular or paracellular pathways, were initially used to
investigate the endothelial permeability and vascular leakage in vitro.
In succession, the transcription and expression levels of TJs in PMVECs
were monitored. The results suggested that this interaction between
PMVECs and PAMs can exert effects on pulmonary microvascular
endothelium, and can then lead to hyperpermeability and endothelial
barrier dysfunction. Meanwhile, the dysregulation of TJ proteins,
including CLDN1, CLDN4, CLDN8, and OCLN, is confirmed to correlate with
the increased permeability of PMVECs in vitro. Given that the presence
and integrity of the intercellular junctions are crucial factors for
maintaining homeostasis and preserving the contacts between the
adjacent endothelial cells of the endothelium to protect them from
excessive paracellular movement, TJs might be important molecules to
relate with PRRSV-induced pathogenesis. The function and regulation
pathway of two important TJs, CLDN4 and CLDN8, during PRRSV infection
have been studied in another project of ours.
Due to vascular permeability being affected by multiple factors, except
for the disassembly of endothelial junctions, both endothelial cell
apoptosis or necrosis and the remodeling of the cytoskeleton might
potentially lead to the observed hyperpermeability [[138]41]. However,
they are not all analyzed in this study, which might be involved in the
future.
In conclusion, the data reveal the dynamic transcriptome profiles and
functions of DEGs in PMVECs co-cultured with HP-PRRSV-inoculated PAMs
in vitro. The results indicate that the secreted permeability factors
produced by HP-PRRSV-infected PAMs can disrupt the integrity of the
PMVEC barrier by upregulating the expression of monocyte-adhesion
molecules and pro-inflammatory cytokines, as well as dysregulation of
TJ proteins to facilitate the passage of circulating immune cell and
erythrocyte escape vasculature locations to establish hemorrhage and
inflammatory cell infiltration ([139]Figure 8). The study provides many
valuable clues for further study on the roles of PMVECs in
PRRSV-induced ALI, which is one of the key directions to explore the
mechanism of PRRSV pathogenesis and reduce PRRSV-induced lesions in the
future.
Figure 8.
[140]Figure 8
[141]Open in a new tab
A proposed model for PRRSV dysregulation of the PMVECs barrier.
HP-PRRSV-infected PAMs produce secreted permeability factors and use
paracrine signaling to communicate with the endothelial barrier during
PRRSV infection. PMVECs secrete pro-inflammatory cytokines and express
cell adhesion molecules on the surface of pulmonary microvascular
endothelium in response to viral infection to aggravate inflammation
and monocyte chemotaxis. Conversely, cell–cell junctions between
adjacent endothelial cells might be disassembled to promote monocytes,
erythrocytes, and fluid flux into tissues.
Author Contributions
L.Z. and W.S. conceived and designed the experiments. W.S., W.W. and
N.J. performed the experiments. W.S., X.G. (Xinna Ge), Y.Z. and J.H.
analyzed the data. X.G. (Xin Guo) and H.Y. supervised the study. W.S.,
X.G. (Xin Guo) and L.Z. wrote and prepared the original draft. L.Z.
modified the paper. All authors have read and agreed to the published
version of the manuscript.
Funding
This research was funded by the National Natural Science Foundation of
China (31772759 and 31972674) and the China Agriculture Research System
of MOF and MARA (CARS-35).
Institutional Review Board Statement
The protocol for primary PAMs preparation was approved by the
Laboratory Animal Ethical Committee of CAU, with approval no.
AW81801202-2-1.
Informed Consent Statement
Not applicable.
Data Availability Statement
The transcriptomic data is available with the link:
[142]ftp://ftp.lc-bio.cn/, accessed on 11 January 2022.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
References