Abstract
Objective
Classical ATP-independent non-shivering thermogenesis enabled by
uncoupling protein 1 (UCP1) in brown adipose tissue (BAT) is activated,
but not essential for survival, in the cold. It has long been suspected
that futile ATP-consuming substrate cycles also contribute to
thermogenesis and can partially compensate for the genetic ablation of
UCP1 in mouse models. Futile ATP-dependent thermogenesis could thereby
enable survival in the cold even when brown fat is less abundant or
missing.
Methods
In this study, we explore different potential sources of
UCP1-independent thermogenesis and identify a futile ATP-consuming
triglyceride/fatty acid cycle as the main contributor to cellular heat
production in brown adipocytes lacking UCP1. We uncover the mechanism
on a molecular level and pinpoint the key enzymes involved using
pharmacological and genetic interference.
Results
ATGL is the most important lipase in terms of releasing fatty acids
from lipid droplets, while DGAT1 accounts for the majority of fatty
acid re-esterification in UCP1-ablated brown adipocytes. Furthermore,
we demonstrate that chronic cold exposure causes a pronounced
remodeling of adipose tissues and leads to the recruitment of lipid
cycling capacity specifically in BAT of UCP1-knockout mice, possibly
fueled by fatty acids from white fat. Quantification of
triglyceride/fatty acid cycling clearly shows that UCP1-ablated animals
significantly increase turnover rates at room temperature and below.
Conclusion
Our results suggest an important role for futile lipid cycling in
adaptive thermogenesis and total energy expenditure.
Keywords: Brown adipose tissue, UCP1-independent thermogenesis, Futile
substrate cycle, Lipolysis, Re-esterification, Fatty acids
Highlights
* •
A futile ATP-consuming triglyceride/fatty acid cycle is main
contributor to heat production in brown adipocytes lacking UCP1.
* •
During active lipolysis, ATGL releases fatty acids from lipid
droplets and DGAT1 mediates fatty acid re-esterification.
* •
UCP1-ablated animals significantly increase triglyceride/fatty acid
cycling rates at room temperature and below.
1. Introduction
A futile cycle is defined as at least two opposing metabolic pathways
being active at the same time, where the forward reaction is competing
with an enzyme or a set of enzymes catalyzing the reverse reaction.
Since the involved reactions are not operating at a near-equilibrium,
substrate flux through a futile cycle will always require the
dissipation (informal: “loss”) of chemical energy as heat. The term
“futile cycle” was coined, because one means of converting chemical
energy into heat is the hydrolysis of ATP, which in the first place
does not seem to be a very favorable concept [[65]1]. However, the
utility of substrate cycles, instead of their futility, was immediately
foregrounded, as soon as the first beneficial aspects were discovered.
Futile cycles can contribute to non-shivering thermogenesis (NST),
confer precise metabolic control, and expand metabolic flexibility in
an energetically challenging setting [[66][2], [67][3], [68][4],
[69][5]].
Futile substrate cycles are a long-standing concept and various
examples have been showcased in an array of different invertebrate and
vertebrate species. Several glycolytic substrate cycles in insects
[[70][6], [71][7], [72][8]], a futile calcium (Ca^2+) cycle in the
heater organ of a large pelagic predatory fish, the blue marlin
[[73]9], an extracellular inter-organ lipid cycle between liver and
adipose tissue as well as an intracellular adipocyte-specific
triglyceride/fatty acid (TG/FA) cycle in rodents and humans [[74][10],
[75][11], [76][12], [77][13], [78][14], [79][15], [80][16], [81][17],
[82][18], [83][19], [84][20]], futile substrate cycling between de novo
FA synthesis and FA oxidation in skeletal muscle of mice [[85]21], and
futile Ca^2+ cycling mediated by sarcoplasmic reticulum calcium ATPase
(SERCA) pump activity in skeletal muscle of mammals, reviewed in
[[86]22]. For thermogenic adipocytes, there has been a recent revival
of interest in futile substrate cycles [[87]23], since ATP driven
cyclic Ca^2+ pumping [[88]24] and cyclic interconversion of
creatine/creatine-phosphate [[89]25] were discovered as contributors to
NST in murine adipose tissues and the control of whole-body energy
homeostasis.
Mice and other small mammals heavily rely on UCP1-mediated NST in the
cold [[90]26], and thus the unexpected cold resistance of UCP1-knockout
(UCP1KO) mice has always been and still is an unresolved mystery
inextricably intertwined with alternative means of thermogenesis and
futile substrate cycles [[91][27], [92][28], [93][29], [94][30],
[95][31]]. Two recent studies have very convincingly shown that UCP1KO
mice increase whole body thermogenesis and specifically interscapular
BAT (iBAT) temperature following adrenergic stimulation
[[96]32,[97]33], yet the futile reactions mediating thermogenesis in
the absence of UCP1 remain unknown. In the light of the limited
capacity of human brown adipose tissue for UCP1-dependent
thermogenesis, resolving the nature of these futile cycles is of
primary interest, as they may play a more important role for human
energy balance [[98]16,[99]34] than mostly assumed so far. In this
study, we explored different UCP1-independent thermogenic pathways in
brown adipocytes of UCP1KO mice and their contribution to cellular heat
production. We analyzed changes in the proteome of wild type (WT) and
UCP1KO adipocytes during acute adrenergic stimulation to detect
characteristic molecular signatures, which allowed us to narrow down
our search to potential candidates related to Ca^2+ and lipid
metabolism. In the next step, we specifically targeted these putative
futile cycles by means of genetic and pharmacological perturbations to
pinpoint the involved enzymes, and corresponding pathways. A futile
cycle of lipolysis and re-esterification of FAs emerged as the
predominant source of UCP1-independent thermogenesis in brown UCP1KO
adipocytes, and therefore we hypothesized that UCP1KO mice would
primarily recruit lipid cycling capacity to aid in maintaining
normothermia. Finally, we attempted to quantify futile lipid cycling in
the adipose tissue of WT and UCP1KO mice at different temperatures, and
indeed observed strong genotype-dependent differences with higher
cycling rates in UCP1KO mice. These results demonstrate that a futile
ATP-consuming cycle of TG lipolysis and FA re-esterification
contributes to NST in brown adipocytes of UCP1KO mice and facilitates
their survival in the cold.
2. Material and methods
2.1. Animals
2.1.1. Animals for cell culture
129Sv/S1 UCP1KO^+/- mice were bred at the animal facility of the
Technical University of Munich as approved by the Government of Upper
Bavaria and in accordance with the German Animal Welfare Act. All mice
were kept under controlled housing conditions (55% relative humidity,
23 °C ambient temperature, 12 h/12 h light dark cycle) and had ad
libitum access to food and water. Homozygous UCP1KO and WT mice were
used for the isolation of primary pre-adipocytes (see [100]2.4). This
animal model was developed by Dr. Leslie P. Kozak [[101]26].
2.1.2. Animals for analysis of brown adipose tissue proteome
WT and UCP1KO mice on a C57BL/6N background were generated as described
previously [[102]35]. All animals were bred in a specific pathogen-free
facility under controlled housing conditions (55% relative humidity,
23 °C ambient temperature, 12 h/12 h light dark cycle) and had ad
libitum access to food and water. The experiments were performed
according to the German Animal Welfare Act with permission from the
Government of Upper Bavaria (Regierung von Oberbayern, reference number
ROB-55.2-2532.Vet_02-16-166). At the age of 8-weeks, male homozygous
UCP1KO and WT mice were single caged, transferred to climate cabinets
set to 23 °C and 55% relative humidity. Simultaneously, mice were
switched to a control diet (Snifff Cat. No S5745-E702) and divided into
two groups based on body weight. Animals were acclimated to cold as
followed. After 1 week at 23 °C, an experimental group (5 °C) was
gradually acclimatized to cold by decreasing the temperature to 20 °C,
15 °C, 10 °C, and finally 5 °C for 1 week, whereas a control group was
kept at 23 °C (23 °C) for 4 weeks. All mice were killed by CO[2]
asphyxiation and iBAT was dissected, weighed, and immediately snap
frozen in liquid nitrogen. Tissues were stored at −80 °C until further
processing.
2.1.3. Animals for in vivo evaluation of TG synthesis and DNL
Homozygous UCP1KO mice and their WT littermates with C57BL/6J genetic
background were used. These mice were derived from heterozygous
breeding pairs at the animal facility of the Institute of Physiology of
the Czech Academy of Sciences, Prague, Czech Republic, where the animal
experiments were conducted. This animal model was developed by Dr.
Leslie P. Kozak [[103]26] and imported to Prague through the Technische
Universität München, Freising, Germany.
Mice were born and maintained at either 30 °C or 20 °C, 50% humidity,
12 h/12 h light/dark cycle (light from 6 a.m.), with drinking water and
standard chow diet (extruded ssniff R/M−H from Ssniff Spezialdiaten
GmbH, Soest, Germany; metabolizable energy 13 MJ/kg) ad libitum. They
were weaned at 4 weeks of age. At 9 weeks of age, male mice were single
caged and randomly assigned to a 6-week-acclimation to (i) warm (WA,
30 °C); (ii) moderate cold (MCA, 20 °C); and (iii) cold (CA, 6 °C). CA
mice were kept first 3 weeks at 20 °C, then another 3 weeks at 6 °C.
Animals were killed in a non-fasted state by cervical dislocation under
diethyl ether anaesthesia (between 8 and 10 a.m.). Liver, heart,
epididymal WAT (eWAT), inguinal (iWAT), iBAT and quadriceps muscle were
dissected and tissue samples were snap frozen in liquid nitrogen,
EDTA-plasma was collected, and all the samples were stored at −80 °C.
The experiments followed the guidelines for the use and care of
laboratory animals of the Institute of Physiology of the Czech Academy
of Sciences and were approved under protocol no. 48/2019.
2.2. Biochemical analysis of plasma and tissue samples
Plasma levels of TGs and total cholesterol were determined using the
colorimetric enzymatic assays from Erba Lachema (Brno, Czech Republic),
and non-esterified fatty acids were assessed with a NEFA-HR(2) kit from
Wako Chemicals GmbH (Neuss, Germany). Blood glucose levels were
measured by OneTouch Ultra glucometers (LifeScan, Milpitas, CA, USA)
and plasma insulin levels were determined by the Sensitive Rat Insulin
RIA Kit (Merck Millipore, Billerica, MA, USA). Tissue TG content was
estimated in ethanolic KOH tissue solubilisates as before [[104]36].
2.3. In vivo evaluation of TG synthesis and de novo lipogenesis (DNL)-derived
FAs in eWAT and iBAT
TG synthesis and DNL were characterized using in vivo ^2H enrichment of
TGs similarly as before [[105]17]. Two days prior to dissection, mice
were injected intraperitoneally with a bolus of ^2H[2]O in saline
(3.5 ml per 100 g body weight) and 5% of their drinking water was
replaced by ^2H[2]O for the rest of the experiment in order to obtain
strable 5% ^2H2O content in body water. After dissection, lipids from
eWAT and iBAT were extracted as in FAHFA in [[106]37], except that the
samples were homogenized in a mixture of citric acid and ethylacetate.
Dried organic phase was resuspended in hexane and applied on Discovery
DSC-Si SPE tubes (52 μm, 72 Å; Merck, Darmstadt, Germany). TG fraction
was eluted from SPE tubes with a mixture of hexane and MTBE. Samples
were analyzed using nuclear magnetic resonance (NMR) spectroscopy.
^1H and ^2H NMR spectroscopy was performed as before [[107]17,[108]18]
using AVANCE III HD 500 MHz system (Bruker Corporation) equipped with
^19F lock and a 5-mm CP BBO-^1H&^19F–^2H probe. The spectra were
analyzed using MestReNova and spectral deconvolution was used in case
of ^2H for integration of signals. The amount of ^1H and ^2H in both
glycerol and fatty-acyl moiety of TGs was calculated from the peak area
relative to the peak of the pyrazine ^1H/^2H standard. Since ^2H can be
incorporated into glycerol moiety of TGs only before esterification of
FAs to glycerol, and glycerol formed during lipolysis in WAT is assumed
to be released into the circulation and not converted to
glycerol-3-phosphate in situ [[109]38], TG positional ^2H enrichment of
the glycerol moiety reflects the rate of TG synthesis. Enrichment of
newly synthesized glycerol-3-phosphate from ^2H[2]O is assumed to be
stoichiometric for all five positional hydrogens regardless of the
relative contributions of glycolysis and glyceroneogenesis [[110]39].
Similarly, ^2H enrichment of FA methyls in TGs correlates with DNL
rate. Measurement of fractional TG/FA cycling draws on previously
validated assumptions of glycerol ^2H-enrichment from body ^2H-enriched
water [[111]39].
2.4. Isolation of primary pre-adipocytes and differentiation into adipocytes
Stromal vascular fraction (SVF) was isolated from iBAT of 5–7 week old
WT and UCP1KO mice as previously described [[112]40]. Mice were
euthanized by CO[2]-asphyxiation and iBAT was dissected. Adipose tissue
was mechanically minced followed by enzymatic digestion (collagenase)
under constant agitation. Large cell debris and undigested pieces of
tissue were removed from the homogenate by filtration (250 μm mesh).
SVF was separated from mature adipocytes by centrifugation.
Contaminating erythrocytes were lysed with an NH[4]Cl-based buffer. SVF
containing pre-adipocytes was pelleted, washed, resuspended in growth
medium (DMEM supplemented with 20% FBS, antibiotics, and an antifungal
agent), and filtered through a 40 μm cell strainer prior to plating.
Growth medium was replaced every other day. When cells reached 80–100%
confluency (day 0) growth medium was replaced with induction medium
(DMEM supplemented with 10% FBS, antibiotics, 5 μg/ml insulin, 1 nM T3,
125 μM indomethacin, 500 μM IBMX, 1 μM dexamethasone, and 1 μM
rosiglitazone). After 48 h (day 2) induction medium was removed and
differentiation medium (DMEM supplemented with 10% FBS, antibiotics,
5 μg/ml insulin, 1 nM T3, and 1 μM rosiglitazone) was added.
Differentiation medium was replaced every other day for 6 days until
cells were considered as fully differentiated adipocytes (day 8). SVF
isolated from iBAT and differentiated into mature adipocytes was
considered as brown adipocytes.
2.5. siRNA-mediated gene silencing
Reverse transfection with DsiRNA or Negative Control DsiRNA (Integrated
DNA Technologies) was carried out on day 7 of the differentiation
procedure as previously published [[113]40]. 25 μl of transfection mix
(OptiMEM supplemented with 30 μl/ml Lipofectamine™ RNAiMAX and 300 nM
DsiRNA) per well were added into a Seahorse XF96 cell culture plate and
incubated for 20 min at room temperature. Differentiated adipocytes
were detached with trypsin and collagenase. Adipocytes were spun down
and resuspended in an appropriate volume of differentiation medium
(without antibiotics). 125 μl of cell suspension was added to each well
of a Seahorse XF96 cell culture plate. After 24 h medium was removed
and fresh differentiation medium (containing antibiotics) was added.
After another 48 h cells were subjected to oxygen consumption analysis
(day 10). RNA was isolated from cells following the respiration assay
and knockdown efficiency was determined by qPCR.
2.6. Microplate-based respirometry
Cellular oxygen consumption was measured at 37 °C with an XF24 or XF96
Extracellular Flux Analyzer as previously published [[114]40].
Adipocytes were assayed on day 8 (regular culture conditions) or day 10
(DsiRNA-mediated knockdown). On the day of the assay differentiation
medium was removed, cells were washed twice with respiration base
medium (DMEM base, Sigma–Aldrich D5030, supplemented with 25 mM
glucose, 2 mM GlutaMAX™, 31 mM NaCl and 15 mg/l phenol red), and, if
not otherwise stated, respiration assay medium (respiration base medium
supplemented with 20 mg/ml essentially fatty acid-free BSA) was added
to a final volume of 180 μl per well (inhibitors were already added to
the assay medium and were present in the medium during the measurement,
see 2.8 “Chemicals and inhibitors”). Cells were incubated for 1 h at
37 °C in a laboratory non-CO[2] incubator prior to the measurement. One
measurement cycle consisted of a 4 min “Mix”, no “Wait”, and a 2 min
“Measure” period. If not otherwise stated, injections were added in the
following order: Isoproterenol (Iso, 100 nM), oligomycin (Oligo, 5 μM),
carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP, 7.5 μM),
and antimycin A (AA, 5 μM). Concentrations are final concentrations in
wells. Since extracellular acidification rate (ECAR) is not a suitable
measure of glycolytic flux of adipocytes during active lipolysis
[[115]40], we did not include these data. OCR metrics were calculated
as follows:
[116]Figure 2A:
[MATH: Oligomycin−sensitivepart of Isoproterenol−stimulated OCR(%)=(maximumafterisoproterenol−mini
mumafteroligomycin)(maximumafterisoproterenol−mini
mumpriortoisoproterenol)∗100 :MATH]
Figure 2.
[117]Figure 2
[118]Open in a new tab
Futile calcium cycling does not contribute to cellular thermogenesis in
murine brown UCP1-knockout adipocytes. A) Seahorse XF24 extracellular
flux measurement of primary cultures of fully differentiated 129Sv/S1
brown wild type (WT) and UCP1-knockout (UCP1KO) adipocytes and
quantification of the oligomycin-sensitive part of stimulated oxygen
consumption rate (OCR). n = 10–12 wells from two independent biological
experiments. A two-tailed Welch-test was applied. Asterisk (∗)
indicates a significant difference between the two groups.
Isoproterenol (Iso), oligomycin (Oligo), carbonyl
cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP), antimycin A (AA).
B) & C) XF96 extracellular flux measurements of primary cultures of
fully differentiated 129Sv/S1 brown UCP1KO adipocytes. B) Atp2a2 was
knocked down in brown UCP1KO adipocytes with DsiRNA as described in
“Material & Methods” and the isoproterenol-induced increase in OCR was
calculated. n = 17–25 wells from three independent biological
experiments. A two-tailed t-test was applied. Not statistically
significant (n.s.). C) Brown UCP1KO adipocytes were acutely treated
with thapsigargin (5 μM final) or BAPTA (20 μM final) for 1 h and the
response to isoproterenol was monitored (left). Compounds were added as
an injection via port “A”. The isoproterenol-induced increase in OCR
over basal OCR (middle) and over OCR after the addition of compounds
(right) was calculated. n = 18–23 wells from three independent
biological experiments. One-way ANOVA followed by Tukey's HSD was
applied. “a” indicates a significant difference from the control group.
Not statistically significant (n.s.).
[119]Figure 2, [120]Figure 3, [121]Figure 4C, and [122]Supplementary
Figs. 2B and 2C:
[MATH: Isoproterenol−stimulated OCR divided by basal OCR <
/mtext>(%)=(maximumafterisoproterenol−mini
mumafterantimycinA)(minimumpriortoisoproterenol−mini
mumafterantimycinA)∗100 :MATH]
Figure 3.
[123]Figure 3
[124]Open in a new tab
A futile cycle of lipolysis and re-esterification of fatty acids
mediates non-shivering thermogenesis in brown UCP1-knockout adipocytes.
A) – F) XF96 extracellular flux measurements of primary cultures of
fully differentiated 129Sv/S1 brown UCP1-knockout (UCP1KO) adipocytes.
A) Cells were pre-treated with an HSL inhibitor (HSLi, 20 μM final), an
ATGL inhibitor (ATGLi, 40 μM final), or both inhibitors (ATGLi + HSLi)
for 1 h prior to the measurement and inhibitors were present in the
assay medium throughout the measurement. Isoproterenol-induced increase
in oxygen consumption rate (OCR) was calculated. n = 18–24 wells from
three independent biological experiments. One-way ANOVA followed by
Tukey's HSD was applied. “a” indicates a significant difference from
the control group, “b” from the HSLi group, and “c” from the ATGLi
group. Not statistically significant (n.s.). B) Oligomycin delivered
via the second injection (port “B”) was replaced with a combination of
the ATGL and the HSL inhibitor. Portion of stimulated OCR sensitive to
oligomycin or lipase-inhibitors was calculated. n = 21 wells from three
independent biological experiments. A two-tailed t-test was applied.
Not statistically significant (n.s.). C) Cells were pre-treated with a
long-chain acyl-CoA synthetase inhibitor (Triacsin C, 5 μM final) for
1 h prior to the measurement and triacsin C was present in the assay
medium throughout the measurement. Isoproterenol-induced increase in
oxygen consumption rate (OCR) was calculated. n = 15–22 wells from
three independent biological experiments. A two-tailed t-test was
applied. Asterisk (∗) indicates a significant difference between the
two groups. D) Cells were pre-treated with a DGAT1 inhibitor (DGAT1i,
40 μM final), a DGAT2 inhibitor (DGAT2i, 40 μM final), or both
inhibitors (DGAT1i + DGAT2i) for 16 h prior to the measurement and
inhibitors were present in the assay medium throughout the measurement.
Isoproterenol-induced increase in oxygen consumption rate (OCR) was
calculated. n = 20–21 wells from three independent biological
experiments. One-way ANOVA followed by Tukey's HSD was applied. “a”
indicates a significant difference from the control group, “b” from the
DGAT2i group, and “c” from the DGAT1i group. Not statistically
significant (n.s.). E) Dgat1 was knocked down in brown UCP1KO
adipocytes with DsiRNA as described in “Material & Methods” and the
isoproterenol-induced increase in OCR was calculated. n = 27–30 wells
from three independent biological experiments. A two-tailed t-test was
applied. Asterisk (∗) indicates a significant difference between the
two groups. F) Palmitate conjugated to bovine serum albumin
(Palmitate:BSA, 160 μM Palmitate:28 μM BSA final) or just BSA (28 μM
final) was added to the BSA-free assay medium immediately prior to
starting the measurement and ATP-linked OCR was quantified. n = 37–43
wells from three independent biological experiments. A two-tailed
t-test was applied. Asterisk (∗) indicates a significant difference
between the two groups. G) 129Sv/S1 brown wild type (WT) and UCP1KO
cells were pre-treated as described in “Material & Methods”, glycerol
and free fatty acids (FFAs) in the medium were quantified, and the
amount of re-esterified FFA was calculated. 2-deoxyglucose (2DG, 50 mM
final). n = two independent biological experiments (within each
experiment, the content of 8 wells of each treatment level was pooled).
Kruskal–Wallis two-way ANOVA followed by multiple comparisons with a
Bonferroni-corrected Mann–Whitney U test was applied. Asterisk (∗)
indicates a significant difference from the control group of the
respective genotype. Number sign (#) indicates a significant difference
between the two genotypes within one treatment level.
Figure 4.
[125]Figure 4
[126]Open in a new tab
Glycolysis fuels UCP1-independent thermogenesis in brown adipocytes
lacking UCP1. A) – C) XF96 extracellular flux measurements of primary
cultures of fully differentiated 129Sv/S1 brown UCP1-knockout (UCP1KO)
adipocytes. A) Cells were assayed in glucose-free medium. Glucose
(25 mM final) or buffer was delivered via the second injection (port
“B”) and the isoproterenol-induced increase in OCR was calculated.
n = 10–16 wells from two independent biological experiments. A
two-tailed t-test was applied. Asterisk (∗) indicates a significant
difference between the two groups. B) Cells were pre-treated with
2-deoxyglucose (2DG, 50 mM final) or a combination of 2DG and pyruvate
(2DG + Pyruvate; 2DG 50 mM final, pyruvate 5 mM final).
Isoproterenol-induced increase in OCR was calculated. n = 16–28 wells
from three independent biological experiments. One-way ANOVA followed
by Tukey's HSD was applied. Asterisk (∗) indicates a significant
difference from the control group. C) Gpd1 was knocked down in brown
UCP1KO adipocytes with DsiRNA as described in “Material & Methods” and
the isoproterenol-induced increase in OCR was calculated. n = 28–31
wells from three independent biological experiments. A two-tailed
t-test was applied. Asterisk (∗) indicates a significant difference
between the two groups.
[127]Figure 2C:
[MATH: Isoproterenol−stimulated increase over basal OCR(pmolO2/min)=maximumafterisoproterenol−minimumpriortoinjection"A" :MATH]
[MATH: Isoproterenol−stimulated increase over OCR after in
jection "A"=maximumafterisoproterenol−mimimumafterinjection"A" :MATH]
[128]Figure 3B:
[MATH: OCR sensitive to Oligomycin or lipase−inhibitors(%)=(maximumafterisoproterenol−mini
mumafteroligomycin/lipa
se−inhi
bitors)(maximumafterisoproterenol−mini
mumpriortoisoproterenol)∗100 :MATH]
[129]Figure 3F:
[MATH: ATP−linked respiration(pmolO2/min)=mimimumpriortooligomycin−minimumafteroligomycin :MATH]
[130]Figure 4A:
[MATH: Isoproterenol−stimulated OCR divided by basal OCR(%)=max
imumafterinjection"B"
minimumpriortoisoproterenol∗100 :MATH]
2.7. Quantification of glycerol and free FAs in cell culture supernatant
Adipocytes were cultured in 96-well plates and the release of glycerol
and free fatty acids into the medium was measured on day 8. Cells were
washed twice with respiration base medium and respiration assay medium
was added to a final volume of 180 μl per well (inhibitors were added
to the assay medium at this point and were present in the medium during
the measurement, see 2.8). The cell culture plate was incubated for 1 h
at 37 °C in a laboratory non-CO[2] incubator. After that,
isoproterenol, oligomycin, or a combination of both was added to the
medium. The cell culture plate was placed back into a laboratory
non-CO[2] incubator and incubated at 37 °C. After an additional hour,
conditioned media were harvested and stored for further analysis. Free
glycerol was determined with the Free Glycerol Determination Kit
(Sigma–Aldrich) and free FAs were quantified with the NEFA-HR(2) Assay
(FUJIFILM Wako Chemicals). Free FA re-esterification rate was
calculated as previously described [[131]10,[132]30]. Free FAs
re-esterified = 3 ∗ glycerol – free FAs.
2.8. Chemicals and inhibitors
Action/inhibitor target Chemical/inhibitor name Final concentration in
well (μM) Incubation time (h)
Adrenergic-β receptor agonist. Isoproterenol 0.1 acute
Inhibits adipose triglyceride lipase (ATGL). Impairs lipolysis.
Atglistatin 40 1
Inhibits hormone-sensitive lipase (HSL). Impairs lipolysis. Hi-76-0079
[[133]41] 20 1
Inhibits carnitine palmitoyltransferase I (CPTI). Impairs import of FAs
into mitochondria. Etomoxir 50 1
Impairs opening of the mitochondrial permeability transition pore.
Cyclosporin A 4.2 72
Competitive inhibition of diacylglycerol O-Acyltransferase 1 (DGAT1).
Impairs TG synthesis and re-esterification of FAs. T863 40 16
Inhibits diacylglycerol O-Acyltransferase 2 (DGAT2). Impairs TG
synthesis. PF-06424439 40 16
Inhibits sarco/endoplasmic reticulum Ca^2+-ATPase (SERCA). Impairs
uptake of Ca^2+ into ER. Thapsigargin 5 1
Selective Ca^2+ chelator. Lowers intracellular Ca^2+ levels. BAPTA-AM
20 1
Shuts down glycolysis/competitive inhibition of glucose-6-phosphate
isomerase. 2-deoxy-d-glucose (2DG) 50,000 1
Competitive inhibition of long chain fatty acyl-CoA ligase (or
synthetase). Impairs activation of FAs. Triacsin C 5 1
[134]Open in a new tab
2.9. RT-qPCR
2.9.1. Cultured cells
Total RNA was isolated by TRIsure™-chloroform extraction and subsequent
column purification using columns from the SV Total RNA Isolation
System (Promega) according to the manufacturer's recommendations.
First-strand cDNA synthesis was performed with SensiFAST™ cDNA
Synthesis Kit (Bioline). 5 ng of cDNA were employed per qPCR reaction.
RT-qPCR was carried out on a LightCycler®480 Real-Time PCR System
(Roche) using SensiMix™ SYBR® No-ROX Kit (Bioline). Relative transcript
abundance was quantified with an arbitrary standard curve consisting of
pooled cDNA from various samples. Relative transcript abundance was
normalized to the expression of Gtf2b. Gene abbreviations and an
overview of primer sequences are given in [135]Table 1.
Table 1.
Primer cell culture.
Gene Name Gene ID Forward primer Reverse primer
Atp2a2 11938 ACCTTTGCCGCTCATTTTCCAG AGGCTGCACACACTCTTTACC
Dgat1 13350 GGAATATCCCCGTGCACAA CATTTGCTGCTGCCATGTC
Dgat2 67800 CCGCAAAGGCTTTGTGAA GGAATAAGTGGGAACCAGATCAG
Gpd1 14555 CCTTGTGGACAAGTTCCCCTT GACAGTCCTGATGACGGGTG
Gtf2b 229906 TGGAGATTTGTCCACCATGA GAATTGCCAAACTCATCAAAACT
[136]Open in a new tab
2.9.2. Tissues
Total RNA was isolated and gene expression was evaluated as described
[[137]42]. Data were normalized to the geometric mean signal of two
reference genes in iBAT (18Srna and Eef1a1) or to Eef1a1 in eWAT. For
data normalization Ln, Log10, or sqrt transformation was used when
needed. The delta–delta CT method [[138]43] was used for calculating
relative changes in gene expression between both tissues. Gene
abbreviations and an overview of primer sequences are given in
[139]Table 2.
Table 2.
Primer tissues.
Gene Name Gene ID Forward primer Reverse primer
18Srna/Rn18s 19791 GCCCGAGCCGCCTGGATAC CCGGCGGGTCATGGGAATAAC
Acly 104112 GTGGCGGGGAAGTGCTGTTTGA TGTGCTCGGGCTGGGAAGGAC
Aqp7 11832 CTTGGGTTTTGGATTCGGAGTGAC GGTCTCCGCCTGCAAAGTGGTTA
Atgl/Pnpla2 66853 CAAGGGGTGCGCTCTGTGGATGG AGGCGGTAGAGATTGCGAAGGTTG
Cd36 12491 TGATACTATGCCCGCCTCTCC TTCCCACACTCCTTTCTCCTCTAC
Cidea 12683 ACTGGCCTGGTTACGCTGGTG GGCTATTCCCGATTTCTTTGGTTG
Dgat1 13350 TGGCCAGGACAGGAGTATTTTTGA CTCGGGCATCGTAGTTGAGCA
Dgat2 67800 TGCCCTACTCCAAGCCCATCACC TCAGTTCACCTCCAGCACCTCAGTCTC
Eef1a1 13627 TGACAGCAAAAACGACCCACCAAT GGGCCATCTTCCAGCTTCTTACCA
Fas/Fasn 14104 TGGGTGTGGAAGTTCGTCAG GTCGTGTCAGTAGCCGAGTC
Gk 14933 TCGTTCCAGCATTTTCAGGGTTAT TCAGGCATGGAGGGTTTCACTACT
Gpd1 14555 GCAGACACCCAACTTTCGCATCA CCGCCGCCTTGGTGTTGTCA
Lcad/Acadl 11363 TGGCATCAACATCGCAGAGAAACA ACCGATACACTTGCCCGCCGTCAT
Ldha 16828 GTTGCCGGCGTCTCCCTGAA CGTAGGCACTGTCCACCACCTG
Ldhb 16832 TCCAGTGTGGCTGTGTGGAGCG AGGCCGATGGCCCAGTTGGT
Lpl 16956 AGCCCCCAGTCGCCTTTCTCCT TGCTTTGCTGGGGTTTTCTTCATTCA
Mct1/Slc16a1 20501 GGCCACCACTTTTAGGCCGC TCGTCGACATCGGTGCTGGC
Mct4/Slc16a3 80879 GGGCAGTGGTCTGTTCACCCT ATGGGGCTCCCTCCCTTGCTA
Pc 18563 CCCCTGGATAGCCTTAATACTCGT TGGCCCTTCACATCCTTCAAA
Pepck/Pck1 18534 GGCAGCATGGGGTGTTTGTAGGA TTTGCCGAAGTTGTAGCCGAAGAAG
Pygl 110095 AGCCAGCGCCTCGGGGTAAT ACGCGGTGAACGGTGTAGCA
Ucp1 22227 CACGGGGACCTACAATGCTTACAG GGCCGTCGGTCCTTCCTT
[140]Open in a new tab
2.10. Western blotting
Frozen iBAT samples (−80 °C) were weighed and RIPA buffer (150 mM NaCl,
1% Nonidet NP-40, 1% sodium deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0,
1 mM PMSF, 1 μg/ml leupeptin, 1 μg/ml aprotinin, 1 μg/ml pepstatin) was
added in 10x dilution (approximately tissue:buffer 1:9). Samples were
homogenized in ice-cold buffer using a ball mill MM40 (Retsch, Germany;
30 s^−1, 3 min). Protein concentration was assessed by bicinchoninic
acid method, and the amount of protein per whole tissue depot was
calculated. iBAT homogenates (10 μg protein/well) were loaded onto a
10% Tricine SDS-PAGE gel. Electrophoresis and western blotting were
performed as described before [[141]44]. OXPHOS proteins were detected
by using Total OXPHOS Blue Native WB Antibody Cocktail (Abcam,
ab110412, 1:250), which includes antibodies against following OXPHOS
subunits: NDUFA9 (complex I), SDHA (complex II), UQCRC2 (complex III),
COX4 (complex IV), ATP5A1 (complex V). Alexa Fluor 680 goat anti-mouse
was used as secondary antibody. GAPDH was detected as reference
protein; GAPDH (14C10) Rabbit mAb (#2118, Cell Signaling, 1:1000). IR
Dye 800 CW Donkey anti-Rabbit IgG Secondary Antibody (Li-cor) was used
as secondary antibody. Fluorescence was detected using an Odyssey
Imager (Li-cor) and the signal was quantified with Image Lab software
(Bio-Rad Laboratories). Intensities of OXPHOS proteins were normalized
to GAPDH and recalculated per whole iBAT depot.
2.11. Proteome analysis
2.11.1. Cells lysis and protein digestion
Cells lysis was performed by adding 100 μl of lysis buffer consisting
of 8 M urea in 50 mM Tris–HCl pH 8, in the presence of EDTA-free
protease inhibitors cocktail (Roche) and phosphatase inhibitors
mixture. Lysates were then sonicated in a Bioruptor Pico (Diagenode)
using a 10 cycles program (30 s ON, 30 s OFF), and cleared by
centrifugation for 10 min at 20,000 g and 4 °C. iBAT samples were
further lysed by mechanical disruption with single use pestles in
protein Lobind tubes and on ice. Protein lysates (100–200 μg) were
reduced with 10 mM DTT at 37 °C for 40 min, and alkylated with 55 mM
chloroacetamide at room temperature for 30 min in the dark. For tryptic
digestion, proteins were digested overnight at 37 °C with sequencing
grade modified trypsin (Promega, 1:50 enzyme-to-substrate ratio) after
4-fold dilution with 50 mM Tris–HCl, pH 8. Digests were acidified by
addition of formic acid (FAc) to 5% (v/v) and desalted using Sep-Pak
C18 cartridges, as previously described [[142]45]. Eluted peptides were
then frozen at −80 °C and dried in vacuo.
2.11.2. TMT labeling and peptide fractionation
TMT 10-plex or TMTpro 16-plex labeling was performed as previously
described [[143]45]. In brief, each digest was resuspended in 20 μL of
50 mM HEPES (pH 8.5). Five μL of 11.6 mM TMT reagents stock solution
(Thermo Fisher) in 100% anhydrous ACN were then added to each sample.
Labeling reaction was carried for 1 h at 25 °C, and quenched by adding
2 μL of 5% hydroxylamine. Peptide solutions were pooled and acidified
using 20 μL of 10% FAc. The pooled sample was dried in vacuo, desalted
and stored dried at −80 °C until further use.
For whole proteome analysis of WT and UCP1KO, dried peptides were
re-suspended in 10 mM ammonium acetate, pH 4.7, and subjected to
trimodal mixed mode chromatography on an Acclaim Trinity P1
2.1 × 150 mm, 3 μm column (Thermo Fisher) operated by a Dionex Ultra
3000 HPLC system (Thermo Fisher) [[144]46]. A total of 32 fractions
were collected.
For whole proteome analysis of iBAT, dried peptides were re-suspended
in 2.5 mM ammonium bicarbonate, pH 8 and subjected to high pH RP
fractionation instead, using a Waters XBridge BEH130C18 2.1 × 150 mm,
3.5um column (Waters). Buffer A was 25 mM ammonium bicarbonate
(pH = 8), buffer C was 100% ultrapure water, buffer D was 100% CAN. The
proportion of buffer A was kept at 10% at all times. Peptides were
separated by a linear gradient from 7% D to 45% D in 44 min, and
followed by a linear gradient from 45% D to 85% D in 6 min. A total of
96 fractions were collected every 30 s, and then concatenated to 48
fractions by adding fraction 49 to fraction 1, fraction 50 to fraction
2 and so forth.
All fractions were dried in vacuo and stored at −20 °C until nLC-MS/MS
analysis.
2.11.3. LC-MS/MS
Nano flow LC-ESI-MS measurements were performed using a Dionex Ultimate
3000 UHPLC + system coupled to a Fusion Lumos Tribrid mass spectrometer
(Thermo Fisher). Peptides were delivered to a trap column
(75 μm × 2 cm, packed in-house with 5 μm Reprosil C18 resin; Dr.
Maisch) and washed using 0.1% FAc at a flow rate of 5 μL/min for
10 min. Subsequently, peptides were transferred to an analytical column
(75 μm × 45 cm, packed in-house with 3 μm Reprosil C18 resin, Dr.
Maisch) applying a flow rate of 300 nL/min. Peptides were
chromatographically separated using a 50 min linear gradient from 8% to
34% solvent B (0.1% FAc, 5% DMSO in ACN) in solvent A (0.1% FAc in 5%
DMSO).
For the iBAT samples, the Fusion Lumos Tribrid mass spectrometer was
coupled to a micro-flow LC-MS/MS system using a modified Vanquish pump
(Thermo Fisher). Chromatographic separation was performed via direct
injection on a 15 cm Acclaim PepMap 100C18 column (2 μm, 1 mm ID,
Thermo Fisher Scientific) at a flow rate of 50 μl/min, using a 25 min
linear gradient (4%–28%) of solvent B (0.1% FAc, 3% DMSO in ACN) and
solvent A (0.1% FAc in 3% DMSO). The total measurement time for each
sample was 27 min.
The Fusion Lumos was operated in a data-dependent acquisition (DDA) to
automatically switch between MS and MS/MS. Briefly, survey full-scan MS
spectra were recorded in the Orbitrap from m/z 360 to 1300 at a
resolution of 60K, using an automatic gain control (AGC) target value
of 4e5 charges and maximum injection time (maxIT) of 50 ms.
For the MS3-based TMT method, initial MS2 spectra for peptide
identification were recorded in the ion trap in rapid scan mode with a
top speed approach using a 2-s duration (isolation window m/z 0.7, AGC
target value of 1e4, maxIT of 35 ms). Fragmentation was set to CID,
with a NCE of 35% and activation Q of 0.25. Then, for each peptide
precursor, an additional MS3 spectrum for TMT quantification was
obtained in the Orbitrap at 50K resolution (AGC of 5e4 charges, maxIT
of 86 ms). The precursor was fragmented as for the MS2 analysis,
followed by synchronous selection of the 10 most intense peptide
fragments and further fragmentation via HCD using a NCE of 55%. Dynamic
exclusion was set to 90 s.
For the analysis of the TMTpro 16-plex samples, the following
parameters were modified: top speed method duration of 1.2-s, isolation
window m/z 0.6, AGC target value of 1.2e4, maxIT of 40 ms,
fragmentation was set to HCD with a NCE of 32%. MS3 ACG was set 1e5
charges, number of notches 8, and dynamic exclusion was set to 50 s.
2.11.4. Data processing
Peptide and protein identification and quantification was performed
using MaxQuant (version 1.6.0.43) with its built in search engine
Andromeda [[145]47]. Spectra were searched against the UniProtKB
database (Mus musculus, UP000000589, 55431 entries downloaded on
12.2019). Enzyme specificity was set to trypsin, allowing for 2 missed
cleavages, and the search included cysteine carbamidomethylation as a
fixed modification and Ntem-acetylation of protein, oxidation of
methionine as variable modifications. TMT10 was set as label within a
reporter ion MS3 experiment type. Precursor tolerance was set to 5 ppm,
and fragment ion tolerance to 20 ppm. Results were adjusted to 1% false
discovery rate at protein, peptide, and site levels.
TMTpro 16-plex raw data file recorded by the mass spectrometer were
processed and quantified with Proteome Discoverer (version 2.4, Thermo
Scientific). Peak lists were generated with Proteome Discoverer with a
signal-to-noise threshold of 1.5 and searched against the UP000000589
UniProtKB database using SequestHT as search engine. The database
search was performed with the following parameters: a mass tolerance of
±10 ppm for precursor masses, ±0.6 Da for HCD-Ion trap fragment ions;
two missed cleavages allowed; and cysteine carbamidomethylation as a
fixed modification. Methionine oxidation and protein N-term acetylation
were set as variable modifications. The enzyme was specified as
trypsin, with a minimum peptide length of 6 amino acids. All PSMs were
validated with Percolator [[146]48], and results were adjusted to 1%
false discovery rate at protein, peptide and PSM level within Proteome
Discoverer. TMTpro was set as label (static modification) and used by
the Reporter Ions Quantifier node for the peptide and protein
quantification. Default settings were used.
The mass spectrometry proteomics data have been deposited in the
ProteomeXchange Consortium via the PRIDE partner repository [[147]49]
with the dataset identifier PXD025854.
2.11.5. Bioinformatic analysis
Data analysis was performed in Perseus (v. 1.6.1.1 and v. 1.6.15.0)
[[148]50] and R [[149]51]. Proteome datasets were filtered to remove
contaminants and decoy identifications, before performing data
normalization of the intensity values by median centering, as
implemented in Perseus.
For statistical tests, only proteins that have been quantified in at
least 3 biological replica were considered. To identify significantly
regulated proteins Welch's t-test was used, corrected for multiple
hypotheses using a Benjamini-Hochberg false discovery rate of 5%.
iBAT proteome dataset was filtered to retain only proteins that have
been quantified in all the 4 biological replica in at least one
experimental condition, and missing values were imputed in Perseus
using default settings. Here, to identify significantly modulated
proteins ANOVA test was used, corrected for multiple hypotheses using a
Benjamini-Hochberg false discovery rate of 5%, and followed by Tukey
HSD post-hoc test in R. Heatmaps were generated in R using the package
“pheatmap”. Normalized protein intensities were scaled in the row
direction and rows were clustered by Euclidean distance.
Gene ontology (GO) annotations were downloaded from UniProt.
Categorical annotation was supplied by Gene Ontology biological
process, molecular function, and cellular component; and the KEGG
pathway database. The GO terms enrichment was calculated on the basis
of a fisher's exact test with a false discovery rate value of 0.05.
Scores were plotted as a two-dimensional annotation enrichment score
[[150]52].
2.12. Electron microscopy
For electron microscopy, cells were grown in flat BEEM capsules (Plano
GmbH, Wetzlar, Germany). Samples were fixed with 2.5% glutaraldehyde in
0.1 M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences,
Hatfield, USA) for 24 h at minimum. Thereafter glutaraldehyde was
removed and samples were washed three times with 0.1 M sodium
cacodylate buffer, pH 7.4. Postfixation and prestaining was done for
30 min with 1% osmium tetroxide (10 ml 4% osmium tetroxide (Electron
Microscopy Sciences), 10 ml ddH2O, 10 ml 3.4% sodium chloride and 10 ml
4.46% potassium dichromate (pH adjusted to 7.2 with KOH (Sigma
Aldrich)). Samples were washed three times with 0.1 M sodium cacodylate
buffer, pH 7.4 and dehydrated with an ascending ethanol series (10 min
with 30%, 50%, 70%, 90% and 96%, respectively, two times 20 min with
100%, and 20min with dehydrated EtOH (molecular sieve 3A°)). For
embedding, EtOH was stepwise replaced by Epon (3.61 M glycidether 100,
(Serva Electrophoresis GmbH), 1.83 M methylnadicanhydride (Serva
Electrophoresis GmbH), 0.92 M dodecenylsuccinic anhydride (Serva
Electrophoresis GmbH), 5.53 mM 2,4,6-Tris(dimethylaminomethyl)phenol
(Serva Electrophoresis GmbH)). (1) 20min with Epon:100% EtOH at a ratio
of 1:1, (2) 20 min with Epon:100% EtOH at a ratio of 2:1, (3) Epon
overnight, (4) replacement with fresh Epon. The embedded samples were
hardened at 60 °C for 48 h. Ultrathin sections were sliced with an
Ultramicrotome (Ultracut E; Reichert und Jung, Germany) and
automatically stained with UranyLess EM Stain (Electron Microscopy
Sciences) and 3% of lead citrate (Leica, Wetzlar, Germany) using the
contrasting system Leica EM AC20 (Leica, Wetzlar, Germany). The samples
were examined with a JEOL-1200 EXII transmission electron microscope
(JEOL GmbH, Freising, Germany). Images were taken using a digital
camera (KeenViewII, Olympus, Germany) and processed with the iTEM
software package (anlySISFive; Olympus, Germany). Images were analyzed
with Fiji [[151]53]. Cytoplasmic and peridroplet mitochondria were
manually counted. Mitochondria were classified as cytoplasmic
mitochondria, if no clear contact site between mitochondrial and lipid
droplet membrane was identified. Mitochondria were classified as
peridroplet mitochondria, if at least one contact site was detected
(the mitochondrial membrane could not be distinguished from the lipid
droplet membrane). Lipid droplet perimeter as well as the sections of
the lipid droplet perimeter occupied by mitochondria was manually
quantified.
2.13. Statistical analyses
If not stated otherwise, data are presented as mean ± SEM.
Comparison of two groups: Normal distribution of data was tested using
the Shapiro–Wilk test. Normally distributed data were compared with an
unpaired t-test. When data violated the assumptions for a t-test, a
Welch-test was performed.
Comparison of three or more groups: Normal distribution of residuals
was tested using the Shapiro–Wilk test, and homogeneity of variance was
assessed by Levene's test. If ANOVA's assumptions were met, one-way or
two-way ANOVA was performed followed by Tukey's HSD multiple
comparisons. When data violated the assumptions for an ANOVA, a
Kruskal–Wallis one-way or two-way ANOVA was performed followed by
multiple comparisons with a Bonferroni-corrected Mann–Whitney U test.
Values of p < 0.05 were considered statistically significant.
3. Results
3.1. Adrenergic stimulation causes an acute upregulation of proteins related
to Ca^2+ and lipid metabolism in brown UCP1KO adipocytes
Several potentially thermogenic futile substrate cycles in adipose
tissue of WT and UCP1KO mice have been reported [[152][23], [153][24],
[154][25],[155]31]. We hypothesized that isoproterenol treatment of
brown adipocytes from UCP1KO mice would cause an immediate acceleration
of futile substrate cycling, and entail a consecutive upregulation of
the involved enzymes to recruit additional capacity. Therefore, we
embarked on probing the cellular response of brown adipocytes of WT and
UCP1KO mice to acute adrenergic stimulation at the protein level to
identify differentially expressed candidates for further investigation
in an unbiased manner ([156]Figure 1A). Based on the assumption that
futile substrate cycles contributing to NST are preferentially found in
adipocytes lacking UCP1, we performed a two-dimensional pathway
enrichment analysis [[157]52] and focused primarily on the terms, which
were downregulated or unchanged in WT cells, and upregulated in KO
cells ([158]Figure 1B). In a broad sense, terms meeting these criteria
were either related to Ca^2+ metabolism (“cardiac muscle contraction”,
“muscle contraction”), lipid metabolism (“cellular lipid metabolic
process”, “glycerophospholipid metabolism”), or the electron transport
chain (“oxidative phosphorylation”, “hydrogen transport”). These
genotype-dependent differences in the proteome upon adrenergic
stimulation can be further assigned to specific cellular compartments.
Significantly adrenergically regulated proteins of brown UCP1KO
adipocytes were, based on their annotation, preferentially localized to
the endoplasmic reticulum (ER), lipid droplets, and the inner
mitochondrial membrane ([159]Supp. Figure 1A). When looking at
individual enzymes involved in the transport of Ca^2+ into the ER
(SERCA isoforms) and the efflux of Ca^2+ back into the cytosol, we
correspondingly observed a strong induction only in UCP1KO adipocytes
([160]Supp. Figure 1B). Additionally, brown adipocytes lacking UCP1
showed a more pronounced upregulation of enzymes that directly or
indirectly participate in TG synthesis compared to WT adipocytes
([161]Supp. Figure 1C, left). On the contrary, we saw a marked
reduction of proteins catalyzing the provision of acetyl-CoA, or DNL,
as well as transcription factors that positively regulate the lipogenic
machinery in UCP1KO cells, while we could not detect a significant
change in WT adipocytes ([162]Supp. Figure 1C, right).
Figure 1.
[163]Figure 1
[164]Open in a new tab
Proteins associated with futile calcium and lipid cycling are acutely
upregulated during active lipolysis in brown UCP1-knockout adipocytes.
A) Schematic depiction of sample generation, processing, and subsequent
proteome analysis. Primary cultures of fully differentiated 129Sv/S1
brown wild type (WT) and UCP1-knockout (UCP1KO) adipocytes were
stimulated with 500 nM isoproterenol (Iso) for 30 min. WT and UCP1KO
samples were processed and analyzed separately. Pathway enrichment
comparing Iso versus no treatment (Con) was performed within each
genotype. The complete set of processed mass spectrometry data can be
found in [165]Supp. Table 2. B) Two-dimensional annotation enrichment
analysis showing biological processes and pathways, which are
significantly regulated upon adrenergic stimulation in at least one of
the two genotypes. Terms that are preferentially upregulated in
stimulated UCP1KO adipocytes and downregulated or not affected in WT
cells are located above the x-axis and near or to the left of the
y-axis. Values between 0 < x ≤ 1 indicate an upregulation after the
addition of isoproterenol, whereas values between −1 ≤ x < 0 indicate a
downregulation. Terms related to futile substrate cycles are
highlighted in red. Not all terms are displayed due to overlapping
points. The complete set of pathways can be found in [166]Supp.
Table 3. n = 5 independent biological experiments.
Taken together, changes in the cellular proteome upon adrenergic
stimulation that were particularly detected in brown UCP1KO adipocytes
suggested the presence of a futile Ca^2+ cycle and a futile TG
substrate cycle acting separately or in a concerted manner.
3.2. The contribution of futile Ca^2+ cycling and futile TG cycling to
UCP1-independent thermogenesis
It has been known for a long time that adipocytes with very low UCP1
levels drastically increase their oxygen consumption in response to an
adrenergic stimulus [[167]54], while not too long ago the same
phenomenon was described in brown and beige UCP1KO adipocytes
[[168]55]. The decisive difference between brown WT and UCP1KO
adipocytes (i.e. in vitro differentiated adipocytes derived from iBAT
of WT and UCP1KO mice) is that stimulated respiration rates in WT cells
are largely driven by UCP1, and consequently oligomycin-insensitive. On
the contrary, oxygen consumption in UCP1KO cells is not affected by
cyclosporin A ([169]Supp. Figure 2A), which effectively rules out the
possibility that mitochondrial permeability transition pore opening
explains this effect, and at the same time it is almost fully sensitive
to oligomycin treatment proving that brown UCP1KO adipocytes markedly
ramp up aerobic ATP production following the addition of isoproterenol
([170]Figure 2A).
To decipher the mechanism underlying elevated oxygen consumption and
ATP turnover of brown UCP1KO adipocytes we concentrated first on
ATP-dependent Ca^2+ cycling that was proposed to mediate NST in beige
UCP1KO adipocytes [[171]24]. Mechanistically, adrenergic signalling is
thought to activate sarco/endoplasmic reticulum Ca^2+ ATPase2b
(SERCA2b) and the ryanodine receptor 2 (RyR2) leading to ATP-dependent
uptake of Ca^2+ into the ER by SERCA2b and the transport of Ca^2+ back
into the cytosol via RyR2. This increased Ca^2+ flux uncouples
mitochondrial oxygen consumption from oxidative phosphorylation. To
test the contribution of futile Ca^2+ cycling to NST in our model of
brown UCP1KO adipocytes, we knocked down Atp2a2, which is coding for
SERCA2b. Cells treated with a DsiRNA targeting Atp2a2 showed a small
non-significant reduction in respiration rates following the addition
of isoproterenol compared to the control group, despite having an 80%
reduced (not shown) endogenous expression of Atp2a2 ([172]Figure 2B).
However, as another SERCA isoform might have compensated for the
knockdown of Atp2a2, or a different isoform besides SERCA2b may mediate
Ca^2+ cycling in our experimental system, we treated UCP1KO adipocytes
with thapsigargin, a potent non-competitive inhibitor of all SERCA
isoforms. In line with the outcome of the knockdown experiments,
pharmacological inhibition of SERCA did not decrease maximal oxygen
consumption rates in response to adrenergic stimulation
([173]Figure 2C, left). Even though the numerical increase induced by
isoproterenol was significantly smaller in cells treated with
thapsigargin, this is only an artefact, since the acute injection of
thapsigargin already lead to higher respiration rates ([174]Figure 2C,
middle & right). To finally rule out any major contribution of futile
Ca^2+ cycling to cellular thermogenesis, we sought to interrupt
intracellular Ca^2+ flux in an untargeted manner by depleting
endogenous Ca^2+ levels using BAPTA, but failed to detect an effect on
ATP turnover driving respiration ([175]Figure 2C). Although the
proteome analysis has revealed an upregulation of enzymes mediating a
putative Ca^2+ substrate cycle in brown UCP1KO adipocytes, we
demonstrated that Ca^2+ cycling is not the cause of increased energy
turnover in UCP1 ablated adipocytes during adrenergic stimulation.
Accordingly, we continued to further pursue the exact molecular source
of NST in UCP1KO adipocytes. The second candidate identified by our
preceding analysis was a futile substrate cycle related to TG
metabolism. In this case, we have chosen a top-bottom approach starting
from very basic and general pathways, and then proceeding to refine
subcomponents in yet greater detail. Lipolysis is a key pathway in
lipid metabolism directly linked to and downstream of canonical
adrenergic receptor-cAMP-PKA-signalling [[176]56]. ATGL and HSL are the
main lipases, which predominantly mediate the enzymatic hydrolysis of
tri – and diacylglycerol into FAs and acylglycerols. Blocking HSL
activity, ATGL activity, or combining both inhibitors reduced the
isoproterenol-induced rise in oxygen consumption of brown UCP1KO
adipocytes by around 25%, 60%, and 85%, respectively ([177]Figure 3A).
This proves that FAs released in response to an adrenergic stimulus are
not inevitably required for mitochondrial ATP synthesis, but instead
directly or indirectly participate in ATP-consuming reactions related
to thermogenesis in the absence of UCP1.
Next, we tested whether a rapid surge in FA levels only provides the
initial impulse or whether FAs need to be permanently released to keep
the cycle going. Acute inhibition of ATGL and HSL activity during
active lipolysis immediately diminished ATP-dependent oxygen
consumption equivalently to oligomycin regarding kinetics and efficacy
([178]Figure 3B). Consequently, the futile substrate cycle in brown
UCP1KO adipocytes strictly depends on active lipolysis, because it is
not only initiated, but also sustained by a continuous supply of FAs
provided by ATGL and HSL lipase activity.
Of note, two mechanistically different futile cycles regarding lipid
metabolism have been proposed in the past: A cycle comprising lipolysis
and re-esterification of FAs [[179][10], [180][11], [181][12],
[182][13], [183][14], [184][15], [185][16], [186][17], [187][18],
[188][19], [189][20]], and a cycle consisting in degradation of FAs
through beta-oxidation, and de novo lipogenesis [[190]21]. Treating
cells with etomoxir, an inhibitor of carnitine palmitoyltransferase 1
(CPT1) as the rate limiting enzyme of the carnitine shuttle, did not
influence oxygen consumption rates of brown UCP1-knockout adipocytes
upon adrenergic stimulation ([191]Supp. Figure 2A). Thus, we could
narrow down the subcellular localization, i.e. exclude the
mitochondrial matrix as a compartment of interest, and rule out the
second option “breakdown of FAs followed by FA re-synthesis”. Based on
these findings and a very characteristic proteome signature, we favored
the idea that murine brown UCP1KO adipocytes would immediately
re-esterify a significant portion of FAs, which are released following
adrenergic stimulation, onto glycerol-3-phosphate (G3P) or mono- and
diglycerides. Since an adrenergic stimulus, such as isoproterenol,
triggers lipolysis and TG synthesis at the same time [[192]57,[193]58],
which are theoretically neutralizing each other's actions, one
important criterion defining a futile substrate cycle is already met.
The second prerequisite, dissipation of chemical energy as heat, would
be fulfilled by the mandatory ATP-dependent activation of FAs preceding
re-esterification onto a glycerol backbone. Therefore, we treated cells
with triacsin C, a substance inhibiting long-chain acyl-CoA synthetase,
and indeed, diminishing FA activation attenuated stimulated oxygen
consumption rates by 50% ([194]Figure 3C). This clearly indicates that
less FAs were activated translating into a reduced ATP demand.
Based on these findings we inferred whether re-esterification of FAs is
causally linked to the increase in oxygen consumption of UCP1KO
adipocytes upon adrenergic stimulation. The final step in the synthesis
of TGs and the quantitatively most important reaction in terms of
(re-)esterification of FAs is catalyzed by diacylglycerol
O-acyltransferase 1 (DGAT1) and DGAT2 [[195]59]. Blocking the action of
DGAT1 diminished the isoproterenol-induced increase in oxygen
consumption rates by 50%, whereas DGAT2 inhibition did not
significantly affect stimulated respiration ([196]Figure 3D).
Pharmacological inhibition of DGAT2 only slightly lowered basal oxygen
consumption, which supports the notion that DGAT1 closely interacts
with ATGL during lipolysis and FA re-esterification [[197]60], while
DGAT2 catalyzes de novo synthesis of TGs under normal conditions
[[198]61]. In a parallel approach, we depleted DGAT1 using siRNA
technology to confirm its role in re-esterification during lipolysis.
Cells that have received a DsiRNA targeting DGAT1 had 40% reduced
oxygen consumption rates following adrenergic stimulation clearly
indicating less futile ATP dependent re-esterification of FAs in brown
UCP1KO adipocytes ([199]Figure 3E). Moreover, the combined inhibition
of DGAT1 and DGAT2 lowered oxygen consumption after the addition of
isoproterenol even further by up to 70% ([200]Figure 3D). This finding
probably reflects the fact that DGAT2 can compensate the loss of DGAT1
activity but only to some very limited extent. Additionally, it should
be noted that a bolus of exogenously supplied FAs without adrenergic
stimulation was in fact sufficient to activate ATP dependent
re-esterification in UCP1KO cells ([201]Figure 3F). This finding is of
particular importance, as it provides a completely new perspective on
futile lipid cycling, which may not be an exclusively intracellular
cycle, but could represent an inter-organ cycle involving different
adipose tissue depots or even non-adipose tissue organs, such as liver
or skeletal muscle [[202]19].
Finally, to obtain an additional and more direct readout of lipid
cycling activity, we calculated re-esterification rates based on the
release of FAs and glycerol of cultured adipocytes under various
conditions [[203]10,[204]30]. Although this method does not consider
recycling of glycerol by glycerol kinase, and that a small amount of
FAs is metabolized through beta-oxidation and used for phospholipid
synthesis, it provides an adequate approximation. In the basal state
brown WT and UCP1KO adipocytes re-esterified a comparable amount of FAs
([205]Figure 3G). UCP1KO adipocytes massively increased their
re-esterification rate upon adrenergic stimulation, whereas WT
adipocytes only showed a small non-significant response. In good
agreement with our findings based on respirometry, inhibiting
mitochondrial ATP synthesis did hardly affect the stimulated FA cycling
rate of WT adipocytes, while 50% of the cycling rate in brown UCP1KO
adipocytes were sensitive to oligomycin treatment ([206]Figure 3G).
Blocking lipolysis completely prevented any increase in
re-esterification rates independent of the genotype. Reducing
ATP-dependent activation of FAs prior to DGAT1 mediated
re-esterification attenuated re-esterification rates by 65% in UCP1KO
cells, whereas WT adipocytes, again, were not significantly affected.
Lastly, the addition of 2-deoxyglucose (2DG), a glucose analogue that
is blocking glycolysis at the level of hexokinase and
glucose-6-phosphate isomerase, caused a massive reduction in the amount
of re-esterified FAs, but only in UCP1KO cells.
Taken together, we demonstrate that brown adipocytes recruit a futile
cycle of lipolysis and FA re-esterification to generate heat in the
absence of UCP1. Our findings prove that activating the adrenergic
receptor-cAMP-PKA-signalling cascade causes lipid turnover to
immediately increase [[207]62]. The main steps defining this futile
substrate cycle include ATGL mediated hydrolysis of TGs, activation of
FAs by long-chain acyl-CoA synthetase under the consumption of ATP, and
esterification of FAs onto diglycerides catalyzed by DGAT1.
3.3. A link between glucose metabolism and futile TG cycling
Interestingly, not only the proteome analysis revealed
“glycolysis/gluconeogenesis” as significantly regulated in response to
an adrenergic stimulus ([208]Supp. Figure 1D), but we also found a
surprisingly strong and causal link between glucose metabolism, i.e.
treatment with 2DG, and the FA cycling rate in UCP1 ablated adipocytes
([209]Figure 3G). This observation is particularly noteworthy, as
glucose uptake per se into brown adipose tissue and cultured brown
adipocytes functions independent of UCP1 [[210]30,[211]63,[212]64].
Nevertheless, the exact intracellular metabolic fate of glucose in
brown UCP1KO adipocytes remains unclear. Glucose can (i) be metabolized
to pyruvate and feed into the TCA cycle, (ii) be converted to lactate
via anaerobic glycolysis supporting ATP synthesis, and (iii) act as a
building block for various metabolic intermediates, such as G3P
[[213]65]. Based on our previous findings, we hypothesized that G3P
derived from glycolysis may represent a significant source of glycerol
backbones onto which activated FAs can be attached. When brown UCP1KO
adipocytes were stimulated with isoproterenol in the absence of
glucose, the increase in oxygen consumption was massively blunted
compared to cells that were assayed in the presence of glucose
([214]Figure 4A), whereas glucose removal had no effect in WT cells
([215]Supp. Figure 2B). However, as soon as glucose was re-introduced
into the system, oxygen consumption of UCP1KO adipocytes immediately
started to rise. To finally prove that a considerable amount of glucose
is converted to G3P in brown UCP1KO adipocytes, cells were treated with
2DG, which is blocking glycolysis. Yet again, the surge in oxygen
consumption following adrenergic stimulation was genotype-dependent and
almost completely absent in UCP1KO cells, i.e. reduced by 85% compared
to the control ([216]Figure 4B), while the effect of 2DG was by far not
as pronounced in WT adipocytes ([217]Supp. Figure 2C). However,
bypassing glycolysis with the addition of exogenous pyruvate was not
able to adequately restore respiration rates, which indicates that
brown UCP1KO adipocytes do not primarily require glucose to produce
pyruvate but possibly to generate G3P backbones for FA
re-esterification. Cellular G3P levels are tightly controlled by the
G3P shuttle, which consists of the two enzymes glycerol-3-phosphate
dehydrogenase 1 (GPD1) and GPD2 [[218]66]. The cytosolic isoform GPD1
catalyzes the conversion of dihydroxyacetonephosphate to G3P.
Consequently, if a significant portion of glucose was converted to G3P
and GPD1 activity contributed to the provision of G3P backbones,
lowering the expression of GPD1 would negatively affect the capacity to
re-esterify FAs without compromising oxidative capacity. In line with
our hypothesis, DsiRNA mediated reduction of Gpd1 expression by 70%
(not shown) resulted in an approximately 30% decrease of oxygen
consumption rates after brown UCP1KO adipocytes were stimulated with
isoproterenol ([219]Figure 4C).
These findings highlight the interdependence of glucose and lipid
metabolism, and clearly suggest that brown UCP1KO adipocytes do not
exclusively convert glucose to pyruvate, but rather metabolize glucose
to G3P via dihydroxyacetonephosphate. Thus, besides transporting
reducing equivalents, G3P can serve as a backbone for re-esterification
of FAs and TG synthesis sustaining futile lipid cycling upon adrenergic
stimulation. This dual role could partially explain the impressive
glucose uptake rates of activated BAT in UCP1KO mice.
3.4. Form follows function: the association of lipid droplets and
mitochondria in brown adipocytes
Although WT and UCP1KO adipocytes respond similarly to adrenergic
stimulation by increasing their oxygen consumption and ramping up
glucose and FA uptake, the respective underlying mechanisms causing
these events are vastly different. Based on a recent publication, which
revealed distinct mitochondrial populations in BAT specialized on
carrying out defined functions [[220]67], we explored the association
between mitochondria and lipid droplets ([221]Figure 5A). Mitochondria
bound to lipid droplets, peridroplet mitochondria (PDM), show
considerable resemblance to cytoplasmic mitochondria (CM) but differ by
having a higher ATP synthesis capacity to support TG synthesis and
lipid droplet expansion [[222]67]. Even in the basal state, almost two
third of all mitochondria in brown UCP1KO adipocytes are associated
with lipid droplets compared to only slightly more than 40% in WT cells
([223]Figure 5B). Additionally, not only the frequency but also the
quality of the association was stronger in UCP1KO cells, since on
average around 30% of total lipid droplet perimeter were occupied by
mitochondria as opposed to less than 20% in WT adipocytes.
Figure 5.
[224]Figure 5
[225]Open in a new tab
Brown UCP1-knockout adipocytes have a higher number of peridroplet
mitochondria and mitochondria are tightly associated with lipid
droplets. A) Representative electron micrograph of a fully
differentiated 129Sv/S1 brown UCP1-knockout (UCP1KO) cell including
lipid droplets, mitochondria, and peridroplet mitochondria (PDM). Scale
bar represents 1 μm “LD” indicates a lipid droplet, “M” a
mitochondrion, and “PDM” a peridroplet mitochondrion. B) (Left)
Relative proportion of PDM in relation to the total number of
mitochondria in 129Sv/S1 brown wild type (WT) and UCP1KO adipocytes.
(Right) Relative proportion of lipid droplet perimeter occupied by
mitochondria. n = 35–46 pictures from two independent biological
experiments. A two-tailed t-test was applied. Asterisk (∗) indicates a
significant difference between the two groups.
3.5. UCP1KO mice recruit a futile cycle of lipolysis and re-esterification
for thermogenesis
We finally addressed whether the futile lipid cycle occurred in vivo
and if so, would it be recruited in response to cold exposure.
Therefore, WT and UCP1KO mice were stepwise acclimated to different
ambient temperatures: 30 °C (warm-acclimated, WA), 20 °C (mild
cold-acclimated, MCA), or 6 °C (cold-acclimated, CA) over at least
three weeks. After the acclimation period, neither genotype nor housing
temperature affected body weight of the animals, but the weight of
individual adipose tissue depots largely differed ([226]Table 3).
Compared to the WA condition, weight of eWAT and iWAT depots in WT mice
progressively decreased in MCA and CA. In UCP1KO mice, eWAT responded
similarly, while iWAT mass was not significantly reduced. In fact, in
UCP1KO mice at CA, iWAT was significantly heavier than in their WT
counterparts. Mass of iBAT of WT mice was lower at MCA, while it was
comparable at WA and CA. On the contrary, iBAT of UCP1KO mice expanded
in CA, with a 2-fold and 1.3-fold elevation of mass in MCA and CA,
respectively ([227]Table 3). This difference in mass was partly due to
a higher protein and TG content of UCP1KO iBAT ([228]Supp. Figure 2D)
and might also be linked to altered glycogen storage. These results
indicate different and depot-specific adaptations to cold exposure in
WT and UCP1-ablated mice. In summary, MCA and CA UCP1KO mice
specifically recruit iBAT mass and preserve iWAT mass.
Table 3.
Energy balance, tissue weights, and blood parameters of C57BL/6J wild
type (WT) and UCP1-knockout (UCP1KO) mice acclimated to different
ambient temperatures: 30 °C “warm-acclimated” (WA), 20 °C “mild
cold-acclimated” (MCA), or 6 °C “cold-acclimated” (CA), for at least
three weeks. n = 9–10 animals from two independent experiments. A
two-way ANOVA followed by Tukey's HSD was applied. “a” indicates a
significant difference from the WA group of the respective genotype.
“b” indicates a significant difference from the MCA group of the
respective genotype. “c” indicates a significant difference between the
two genotypes within one treatment level. Abbreviations: AT, adipose
tissue; eWAT, epididymal white adipose tissue; iBAT, interscapular
brown adipose tissue; NEFA, non-esterified fatty acid; iWAT, inguinal
white adipose tissue; TG, triglyceride.
WA
__________________________________________________________________
MCA
__________________________________________________________________
CA
__________________________________________________________________
WT UCP1KO WT UCP1KO WT UCP1KO
Food consumption (g day ^−1) 2.70 ± 0.10 3.0 ± 0.1 4.4 ± 0.1^a
4.8 ± 0.1^a 7.4 ± 0.1^a,b 7.9 ± 0.2^a,b
Body weight final (g) 27.51 ± 0.66 28.47 ± 1.15 26.97 ± 0.55
28.05 ± 0.41 27.69 ± 0.45 27.63 ± 0.36
Weight of AT depots
eWAT (mg) 500 ± 48 497 ± 84 324 ± 21^a 358 ± 31 194 ± 16^a,b
211 ± 11^a,b
iWAT (mg) 273 ± 21 280 ± 35 213 ± 14 222 ± 12 167 ± 14^a,b 237 ± 13^c
iBAT (mg) 117 ± 7 108 ± 8 94±4^a 185 ± 13^a,c 118±6^b 157 ± 16^a,c
Liver
Weight (mg) 1269 ± 51 1376 ± 82 1430 ± 40 1676 ± 47^a,c 1531 ± 68^a
1683 ± 65^a
TG (mg per g tissue) 16.09 ± 1.73 16.78 ± 1.12 14.91 ± 1.63
22.91 ± 4.19 13.22 ± 1.46 18.57 ± 1.80
Quadriceps muscle
Weight (mg) 270 ± 8 269 ± 10 264 ± 8 296±8^a,c 245±5^a 235±6^a,b
TG (mg per g tissue) 8.03 ± 1.53 10.72 ± 3.25 6.78 ± 1.61 11.86 ± 4.28
5.37 ± 0.79 10.75 ± 2.44
Heart
Weight (mg) 124 ± 3 138±8^c 137±3^a 164±5^a,c 181±7^a,b 222±9^a,b,c
Plasma levels
TG (mmol l ^−1) 1.13 ± 0.07 1.03 ± 0.10 1.08 ± 0.06 0.47 ± 0.04^a,c
0.80 ± 0.09^a,b 0.37 ± 0.04^a,c
NEFA (mmol l ^−1) 0.33 ± 0.04 0.31 ± 0.03 0.33 ± 0.04 0.27 ± 0.03
0.25 ± 0.03 0.13 ± 0.02^a,b,c
Cholesterol (mmol l − 1) 2.03 ± 0.14 1.89 ± 0.12 1.75 ± 0.05^a
1.44 ± 0.05^a,c 1.16 ± 0.11^a,b 1.01 ± 0.08^a,c
Glucose (mg dl ^−1) 7.8 ± 0.4 7.2 ± 0.3 7.8 ± 0.3 7.8 ± 0.4 7.9 ± 0.5
8.4 ± 1.0
Insulin (ng ml ^−1) 0.78 ± 0.17 1.09 ± 0.33 0.75 ± 0.14 0.64 ± 0.18
0.73 ± 0.16 1.85 ± 0.28^a,b,c
[229]Open in a new tab
To assess TG/FA cycling activity in adipose tissue in situ, mice were
treated with ^2H[2]O, and the incorporation of ^2H into glycerol and FA
methyl moieties of TGs was measured [[230]17,[231]18]. ^2H enrichment
of glycerol is determined by the rates of glycolytic provision of G3P
and glyceroneogenesis. Incorporation of ^2H-glycerol in the TG fraction
of cellular lipids (^2H TG-Gly %) depends directly on FA
esterification, and therefore could serve as a qualitative surrogate
marker for TG/FA cycling rates. ^2H enrichment in FA methyl (CH[3])
chains specifically represents FA DNL, because ^2H can only be
incorporated during the reaction catalyzed by fatty acid synthase but
not during FA elongation or desaturation. In general, we did not expect
major differences between genotypes at thermoneutrality, because
thermogenic requirements should be minimal or zero. However, we
hypothesized that with decreasing temperature UCP1KO mice would
substantially ramp up TG/FA cycling rates and primarily in iBAT
([232]Figure 6A). Furthermore, we hypothesized that irrespective of the
genotype, DNL in eWAT could support thermogenesis in iBAT, which may
become even more important at lower temperatures [[233]17]. Since we
noticed sometimes very large differences in depot size between
genotypes at different temperatures ([234]Table 3), we additionally
calculated an overall enrichment rate per depot, ^2H TG-Gly and ^2H
TG-CH3 (mg)/adipose tissue, by including tissue weights.
Figure 6.
[235]Figure 6
[236]Open in a new tab
Futile lipid cycling is recruited for non-shivering thermogenesis in
adipose tissues of UCP1-knockout mice. A) Graphical summary of futile
triglyceride/fatty acid (TG/FA) cycling in adipocytes. In response to a
cold sensation, norepinephrine, here mimicked by isoproterenol, binds
to adrenergic receptors and triggers the downstream cAMP-PKA-signalling
cascade, which leads to the activation of lipolysis. ATGL and
HSL-mediated hydrolysis of TGs and diglycerides (DGs) causes an
immediate increase in cellular FA levels. The majority of newly
released FA in brown UCP1KO adipocytes is re-esterified onto DGs and
possibly to a lesser extent onto monoglycerides (MGs) as well as G3P.
In this setting, more glucose is taken up to replenish the TCA cycle,
maintain protonmotive force, and most importantly to provide G3P
backbones serving as FA acceptor molecules. Primarily DGAT1 but
potentially also other acyltransferases, such as glycerol-3-phosphate
acyltransferases (GPATs) and 1-acylglycerol-3-phosphate
O-acyltransferase (AGPATs), catalyze the esterification of FA derived
from intracellular TG stores or taken up from the circulation, which is
preceded by the ATP-dependent activation. The breakdown of TGs is
simultaneously counterbalanced by re-synthesis, and thus lipid flux in
both directions accelerates causing ATP turnover to increase without
altering metabolite levels. Thereby, ATP consumption, its anaerobic
glycolytic provision, and generation of ATP via oxidative
phosphorylation directly linked to the flux through the mitochondrial
electron transport chain (ETC) can be adjusted by enhancing or reducing
lipid flux, which represents the theoretical foundation of TG/FA
cycling. This figure was created using Servier Medical Art templates,
which are licensed under a Creative Commons Attribution 3.0 Unported
License; [237]https://smart.servier.com. B) Futile TG/FA cycling
activity and de novo lipogenesis in epididymal white adipose tissue
(eWAT) of C57BL/6J wild type (WT) and UCP1-knockout (UCP1KO) mice
acclimated to different ambient temperatures: 30 °C “warm-acclimated”
(WA), 20 °C “mild cold-acclimated” (MCA), or 6 °C “cold-acclimated”
(CA), for at least three weeks. n = 9–10 animals from two independent
experiments. Relative enrichment is shown in top panels; enrichment per
depot considering total tissue weight ([238]Table 3) is shown in bottom
panels. A two-way ANOVA followed by Tukey's HSD was applied. “a”
indicates a significant difference from the WA group of the respective
genotype. “b” indicates a significant difference from the MCA group of
the respective genotype. “c” indicates a significant difference between
the two genotypes within one treatment level. C) Futile TG/FA cycling
activity and de novo lipogenesis in interscapular brown adipose tissue
(iBAT) of WA, MCA, and CA C57BL/6J WT and UCP1KO mice. n = 9–10 animals
from two independent experiments. Relative enrichment is shown in top
panels; enrichment per depot considering total tissue weight
([239]Table 3) is shown in bottom panels. A two-way ANOVA followed by
Tukey's HSD was applied. “a” indicates a significant difference from
the WA group of the respective genotype. “b” indicates a significant
difference from the MCA group of the respective genotype. “c” indicates
a significant difference between the two genotypes within one treatment
level. D) Regulation of proteins potentially involved in TG/FA cycling
in iBAT of C57BL/6N WT and UCP1KO mice acclimated to 23 °C or 5 °C. The
complete set of processed mass spectrometry data can be found in
[240]Supp. Table 4. n = 4 animals. Column labels represent individual
mice: WT (WT23) and UCP1KO (UCP1KO23) mice acclimated to 23 °C, WT
(WT5) and UCP1KO (UCP1KO5) mice acclimated to 5 °C. Row labels
represent gene symbols of proteins. Normalized protein intensities were
scaled by calculating z-scores for each protein. Cell color indicates
z-score. Abbreviations: Long-chain acyl-CoA synthetase (Acsl),
acylglycerol kinase (Agk), 1-acylglycerol-3-phosphate O-acyltransferase
(Agpat), diacylglycerol O-acyltransferase (Dgat), diacylglycerol kinase
epsilon (Dgke), glycerol kinase (Gk), mitochondrial
glycerol-3-phosphate acyltransferase (Gpam), glycerol-3-phosphate
acyltransferase (Gpat), glycerol-3-phosphate dehydrogenase (Gpd),
hormone-sensitive lipase (Lipe), monoglyceride lipase (Mgll), adipose
tissue triglyceride lipase (Pnpla2).
In eWAT ^2H enrichment of glycerol and FAs in TGs was similarly low in
WA mice of both genotypes ([241]Figure 6B). TG/FA cycling activity as
well as DNL gradually increased with cold adaptation, while overall the
largest increment was observed from MCA to CA. When mice were housed at
6 °C, DNL activity was significantly higher in UCP1KO mice and we could
detect a trend for more TG/FA cycling in the absence of UCP1.
Collectively, these data suggest that increased lipid cycling in eWAT,
partly supported by DNL, may contribute to adaptive thermogenesis. The
apparent compensatory upregulation in the absence of UCP1-mediated
thermogenesis could reflect enhanced in situ thermogenesis resulting
from futile lipid cycling, and elevated efflux of FAs into the
circulation serving a dual purpose as energy fuel for thermogenesis or
as a substrate for TG/FA cycling in other tissues. Given the strong
reduction in eWAT mass upon cold exposure and the tissue's relatively
low oxidative capacity, the latter option might be of higher importance
for whole-body energy metabolism and thermogenesis [[242]17]. Gene
expression profiling supports this notion. Thus, a strong upregulation
of genes related to FA biogenesis, such as fatty acid synthase (Fas)
and pyruvate carboxylase (Pc), TG synthesis (Dgat2), and the release of
FAs from lipid droplets (Atgl and Cidea) in eWAT of UCP1KO mice was
observed ([243]Supp. Table 1). Changes in the expression of genes
putatively linked to re-esterification (Dgat1 and Gpd1) of FAs were
relatively small.
Nevertheless, in iBAT relative incorporation of ^2H into glycerol and
FAs of TGs was severalfold higher compared to eWAT ([244]Figure 6C).
TG/FA cycling and DNL in iBAT still increased in a dose-dependent
manner upon cold exposure in mice of both genotypes. In contrast to
eWAT, the difference between WA and MCA animals was by far the most
pronounced, whereas the difference between MCA and CA animals regarding
^2H enrichment was smaller. This indicated that lipid cycling activity
was higher in WA and MCA UCP1KO mice in comparison to the corresponding
WT mice. However, enrichment did not differ between MCA and CA UCP1KO
mice translating into a lower ^2H incorporation into glycerol of TGs in
iBAT of CA UCP1KO as compared to CA WT mice. If enrichment is expressed
per whole depot, the difference becomes even greater between MCA WT and
UCP1KO animals and negligible in CA animals ([245]Figure 6C).
Interestingly, WT mice massively increased DNL during cold exposure,
while we could only detect a very modest upregulation in UCP1KO mice.
Therefore, we concluded that UCP1KO mice preferentially recruit a
futile cycle of lipolysis and re-esterification of FAs in brown
adipocytes for adaptive thermogenesis as compared with WT mice.
Moreover, in the absence of UCP1, NST in iBAT may rather depend on
exogenous substrates and possibly lipoprotein lipase (LPL)-mediated
uptake of FAs from circulating TGs, because TG stores were largely
preserved despite a very modest increase in DNL.
In line with our hypothesis that energy stores in eWAT are sacrificed
to supply other thermogenic tissues, such as iBAT and iWAT,
non-esterified FA (NEFA) concentrations in the plasma of CA UCP1KO mice
were drastically reduced in response to cold exposure ([246]Table 3)
while at the same time Cd36 expression in iBAT, a protein facilitating
the uptake of FAs into cells, was upregulated ([247]Figure 7).
Moreover, Lpl transcript levels in iBAT of CA UCP1KO mice were
positively regulated by cold exposure and significantly higher than in
CA WT mice. Concurrently, plasma TG levels in UCP1-ablated mice were
significantly reduced by 50% compared to their WT counterparts clearly
suggesting that in the absence of UCP1 there is a higher demand for FAs
derived from classical white adipose tissue [[248]17,[249]68,[250]69]
and TG-rich lipoproteins originating from hepatocytes or enterocytes
could support UCP1-independent thermogenesis in iBAT and potentially
also iWAT ([251]Table 3). As expected, Dgat1 expression was
significantly increased in iBAT of MCA and CA mice, with the largest
incremental increase in CA UCP1KO mice ([252]Figure 7). This underlines
the importance of DGAT1-mediated re-esterification directly linked to
TG lipolysis [[253]60], whereas Dgat2 levels were unaffected from cold
exposure in UCP1-ablated mice.
Figure 7.
[254]Figure 7
[255]Open in a new tab
Expression of selected genes in iBAT of C57BL/6J wild type (WT) and
UCP1-knockout (UCP1KO) mice acclimated to different ambient
temperatures: 30 °C “warm-acclimated” (WA), 20 °C “mild
cold-acclimated” (MCA), or 6 °C “cold-acclimated” (CA), for at least
three weeks. n = 4–5 animals (data from one experiment; confirmed in
two independent experiments). “a” indicates a significant difference
from the WA group of the respective genotype. “b” indicates a
significant difference from the MCA group of the respective genotype.
“c” indicates a significant difference between the two genotypes within
one treatment level. Abbreviations of genes: CD36 molecule (Cd36),
diacylglycerol O-acyltransferase 1 (Dgat1), diacylglycerol
O-acyltransferase 2 (Dgat2), glycerol kinase (Gk), glycerol-3-phosphate
dehydrogenase 1 (Gpd1), lipoprotein lipase (Lpl).
Gpd1 levels were markedly increased in MCA UCP1KO animals, while a
further reduction in ambient temperature caused Gpd1 expression to drop
again ([256]Figure 7). Interestingly, gene expression of glycerol
kinase (Gk) stepwise increased with a decreasing ambient temperature.
This was more pronounced in mice lacking UCP1 and MCA was already
sufficient to induce a significant upregulation, as reported previously
[[257]27,[258]70]. Other than serum lipids, plasma glucose levels were
neither affected by the housing temperature nor by the genotype, but
insulin concentrations were significantly elevated in CA UCP1KO mice
([259]Table 3). Increased insulin secretion may funnel more substrates,
such as amino acids, FAs, and glucose, into insulin-responsive tissues
and it could counteract the extensive catabolism of thermogenic adipose
tissues elicited by continuously high sympathetic stimulation.
Therefore, the amount of nutrients supplied to iBAT and iWAT via the
circulation may disproportionately grow as soon as intracellular energy
stores are significantly depleted. In line with this assumption, we
found higher gene expression levels of glycogen phosphorylase (Pygl),
the enzyme mediating glycogen breakdown, in iBAT of cold-exposed WT
animals, while only MCA but not CA UCP1KO mice responded in a similar
way potentially indicating that glycogen stores were already exhausted
when housed at 6 °C ([260]Supp. Table 1). Since transcript levels do
not necessarily correlate well with protein levels, we also examined
cold-induced adaptations with respect to proteins involved in TG/FA
cycling ([261]Figure 6D), other futile substrate cycles ([262]Supp.
Figure 3C), and lipid metabolism ([263]Supp. Figure 3D) in iBAT of WT
and UCP1KO mice in a separate cohort using an additional UCP1-ablated
mouse model. At the protein level, detected changes specifically with
respect to enzymes responsible for activation and esterification of FAs
([264]Figure 6D) as a function of temperature and genotype were in good
agreement with our initial hypothesis and previous observations and
further corroborated the theory that mice lacking UCP1 recruit futile
lipid cycling for NST. Although our functional in vitro data at least
argue against an involvement of futile Ca^2+ cycling, we also found an
induction of proteins associated with Ca^2+ and creatine cycles
([265]Supp. Figure 3C), but we cannot assess whether they significantly
contribute to heat production in vivo and whether flux rates are in
fact increased.
Furthermore, it is extremely interesting that the depletion of the
respiratory chain in iBAT of MCA and CA UCP1KO mice was not as severe
as previously described [[266]71]. We detected small morphological
changes and a few mitochondria with aberrant cristae morphology in
UCP1KO iBAT ([267]Supp. Figure 2E). However, these defects appear to be
minor at room temperature and only a small subset of mitochondria is
affected. At the same time, only NDUFA9 (complex I) and COX4 (complex
IV) were reduced ([268]Supp. Figure 3A). Additionally, ATP5A1 protein
levels, a subunit of the catalytic domain of the mitochondrial ATP
synthase (complex V), were even 1.5-fold and 2-fold higher in MCA and
CA UCP1-ablated mice, respectively. Since the futile TG/FA cycle only
depends on ATP synthesis and turnover, a decreased amount of complex I
to IV would not preclude UCP1-independent thermogenesis as long as
their capacity is high enough to cover the dissipation of protonmotive
force by a fully active ATP synthase. Therefore, we have good reason to
believe that brown fat of cold-acclimated UCP1KO mice is equipped with
the electron transport chain machinery required to substantially
contribute to NST.
Taken together, supported by several lines of evidence, we demonstrate
that UCP1KO mice, and to a lesser extent WT mice, enhance TG/FA cycling
to defend their body temperature in the cold. In the absence of UCP1,
additional futile lipid cycling capacity is not only provided by
expanding iBAT mass, but we also detected a very characteristic
cold-induced transcript and proteome signature in iBAT and eWAT. These
integrated changes in adipose tissue metabolism most likely ensure
sufficient substrates for oxidation in iBAT, readily available and
matching amounts of glycerol backbones and FAs, and the enzymatic
machinery required to orchestrate all reactions involved.
4. Discussion
In the present study, we investigated potential mechanisms of
UCP1-independent heat generation in murine BAT. We identified a futile
substrate cycle of lipolysis and FA re-esterification as the major
source of NST in brown adipocytes of UCP1KO mice. The underlying
theoretical framework that futile substrate cycles and in particular
futile lipid cycling could contribute to NST was proposed 60 years ago
[[269]54]. Since then, the topic has been picked up from time to time
but meanwhile sank into obscurity again, aside from a few exceptions.
Only recently futile cycles experience a renaissance. For decades it
has been known that adipocytes with low UCP1 levels, i.e. white
adipocytes, and since more recently also brown and white UCP1KO
adipocytes, increase their oxygen consumption in response to adrenergic
stimulation [[270]30,[271]54,[272]55,[273]72,[274]73]. Scientists
hypothesized that FAs released during lipolysis may either undergo ATP
dependent re-esterification or degradation through beta-oxidation, or
may cause beneficial mild mitochondrial uncoupling. However, the exact
mechanism of this phenomenon has never been fully resolved, as the
molecular evidence provided was rather anecdotal.
Here we demonstrated that beta-adrenergically stimulated respiration
rates of brown UCP1-knockout adipocytes are fully sensitive to
inhibition of the mitochondrial ATP synthase. Potential mild
non-specific uncoupling due to excess FAs [[275]74,[276]75] or
cyclosporin-sensitive opening of the mitochondrial permeability
transition pore [[277]76,[278]77], as reported previously
[[279]55,[280]72], could be excluded. Our results prove that
mitochondrial beta-oxidation is not in any way part of the futile TG
substrate cycle, other than as a source of reducing equivalents. After
all, we pinpointed a set of key enzymes in TG/FA cycling on a cellular
level and elucidated the role of glucose. A few open questions demand a
critical appraisal of our key findings.
Pharmacological inhibition of long-chain acyl-CoA synthetase activity
(triacsin C), i.e. ATP-dependent activation of FAs, did not fully
abolish oxygen consumption linked to futile TG cycling. This suggests
that either the enzyme was not completely inhibited, since a high
cellular lipid content [[281]78,[282]79] and bovine serum
albumin-buffered assay medium are strongly affecting substance
partitioning and availability [[283]80], or different isoforms
[[284]81] or even short and medium-chain acyl-CoA synthetases also
contribute to the activation of FAs prior to re-esterification during
active lipolysis. Interestingly, triacsin C was ultimately even
slightly more potent than oligomycin in decreasing free FA (FFA)
re-esterification rates. Although oligomycin can fully reverse the
isoproterenol-induced increase in oxygen consumption, a certain amount
of FAs may still be activated and re-esterified as long as glycolytic
ATP production can compensate for the inhibition of the mitochondrial
ATP synthase. Similarly, combining both DGAT inhibitors did not fully
prevent increased respiration rates following adrenergic stimulation.
This may be explained by the activity of different acyltransferases,
such as glycerol-3-phosphate acyltransferases (GPATs) and
1-acylglycerol-3-phosphate O-acyltransferase (AGPATs), which may also
catalyze re-esterification of FAs during active lipolysis. However,
specific and well characterized inhibitors targeting these enzymes are
not available at the moment. Thus, it still has to be resolved if this
futile substrate cycle involves the whole TG synthesis pathway from G3P
to TGs or if it is predominantly restricted to di- and triglycerides.
Since futile lipid cycling activity apparently depends on glycolytic
provision of G3P in vitro, the first steps of lipid synthesis might
also have a greater importance than initially assumed.
Apart from this, the absence of UCP1 may have even more far-reaching
consequences, since we found clear differences between WT and UCP1KO
cells with respect to the interaction between mitochondria and lipid
droplets. Therefore, it is enticing to speculate that this shift in
mitochondrial subpopulations at least partly supports the observed
phenotypic differences. Brown WT adipocytes rely on UCP1 mediated
thermogenesis, and thus would require less PDM and more CM, as CM are
specialized on beta-oxidation fueling thermogenesis. On the contrary,
UCP1KO adipocytes have an increased ATP demand due to higher rates of
FA re-esterification favoring the occurrence of PDM, which may
facilitate heat generation by futile lipid cycling. Monitoring the
dynamic interaction between mitochondria and lipid droplets upon
adrenergic stimulation, or during states of impaired lipid cycling will
clearly show, if the emergence of certain mitochondrial populations
correlates with futile cycling activity, lipid turnover and ATP
consumption.
Finally, we corroborated these new mechanistic insights with
quantitative data on TG/FA cycling in classical white and brown adipose
tissue of WT and UCP1KO mice. The Kozak UCP1KO mouse [[285]26] has made
a great contribution to uncovering the mechanism behind NST in BAT and
characterizing its physiological significance [[286][28], [287][29],
[288][30], [289][31],[290][82], [291][83], [292][84]]. Based on the
substantially reduced effect of norepinephrine on whole body oxygen
consumption in UCP1-ablated mice [[293]82] or in adipocytes isolated
from BAT of these animals [[294]84], it was concluded that only UCP1
mediates adaptive adrenergically-mediated NST [[295]85]. However, with
the application of magnetic resonance (MR) imaging to quantify dynamic
changes in lipid content of BAT as a surrogate measure of NST, Grimpo
and coworkers demonstrated that UCP1KO mice show a thermogenic response
to norepinephrine in iBAT. In stark contrast to the previous
publications mentioned before, the MR imaging approach indicated that
this response was even stronger in cold-acclimated animals, clearly
suggesting an adaptive recruitment of NST capacity in mice lacking UCP1
[[296]32]. In a recent publication using MR thermometry, scientists
observed a significant increase in iBAT temperature of UCP1KO mice
following adrenergic stimulation, which was evidently preceding the
rise in rectal body temperature [[297]33]. Moreover, it has been shown
that acute beta3-adrenergic stimulation induced glucose uptake in BAT
independently of UCP1 and whole-body oxygen consumption [[298]64].
These observations are thus compatible with our results presented in
this study suggesting adrenergic stimulation of UCP1-independent NST in
BAT. Interestingly, a study in rats treated with rosiglitazone gave
very similar results. An upregulation of PPARγ-responsive genes,
including Gpats and specifically Dgat1, lead to 2.2-fold increase in
TG/FA cycling activity at room tenmperature [[299]86], whereas in fact,
TG/FA cycling in iBAT of UCP1KO mice has never been measured before.
Our results support the idea that TG/FA cycling and DNL in white
adipose tissue, together with hepatic very-low-density lipoprotein TG
synthesis, may be involved in controlling blood lipid levels and
providing FAs as fuel for thermogenesis in iBAT and possibly other
tissues during cold exposure [[300]17,[301]32]. Thus, the induction of
both TG/FA and DNL activities in eWAT of CA UCP1KO mice is in agreement
with the induction of cytochrome c oxidase observed in eWAT of UCP1KO
but not WT mice acclimated to cold [[302]28]. Here, we also observed
such a genotype-specific pattern regarding the induction of TG/FA
cycling and DNL in iBAT. Interpretation of these data in iBAT must take
changes of depot mass into consideration, because it is differentially
affected by cold acclimation depending on the genotype ([303]Table 3).
The significant increase in futile lipid cycling activity observed in
MCA UCP1KO mice was even greater when expressed per whole depot. In the
attempt to estimate whole depot capacity, it is probably not sufficient
to merely look at depot size to properly account for effective
genotype-dependent metabolic changes in iBAT, especially since protein
and TG content are differently affected. In fact, we most likely
underestimated TG/FA cycling activity in iBAT of MCA and CA UCP1KO mice
with the true capacity being considerably larger. Directly related,
there is a conceptual limitation of our study pertaining to the
determination of futile lipid cycling activity. The D[2]O-based
labelling approach is only able to capture a certain defined fraction
of the whole futile cycle, as FAs, which are released from tri – and
diglycerides during active lipolysis and re-esterified onto di – or
monoglycerides originating from the lipolytic process itself, will not
be included in the analysis. At least based on our in vitro data, this
particular ATGL-DGAT1-mediated subcycle accounts for the largest share
of newly released and subsequently re-esterified FAs in brown UCP1KO
cells, which could also contribute to the fact that in vivo the
measured difference between WT and UCP1KO mice was smaller than we
would have suspected.
Importantly, the analysis based on in vivo D[2]O-labelling of tissue
lipids includes only G3P backbones provided via glycolysis and
glyceroneogenesis, while G3P derived from GK activity is not, which
makes interpretation of enrichment data more challenging. This does not
pose a problem for white adipose tissue, i.e. eWAT, where GK activity
is negligible. For iBAT, however, there is a growing body of evidence
suggesting considerable GK activity in iBAT and beige adipose tissues
[[304]27,[305]70,[306]87,[307]88]. Cold exposure induces GK expression
specifically in thermogenic adipose tissues. In line with previous
studies [[308]27,[309]70], we found a more pronounced cold-stimulated
induction in iBAT of UCP1-ablated mice. Consequently, TG/FA cycling
rates in UCP1KO mice during cold exposure may be in fact much higher
than initially suspected and the effect of UCP1 ablation could be even
more substantial. Additionally, even if total G3P production remains
unchanged, switching the source of G3P from glycolysis to GK,
regardless of the underlying cause, would be misinterpreted as a
decrease in TG/FA cycling activity. In line with that, we found that
GPD1 transcript and protein levels are lower, and GK levels are
significantly higher in iBAT of UCP1KO mice at lower temperatures and
expression of these two proteins follows a completely different pattern
compared to their WT counterparts. This could indicate that mild cold
stress still allows UCP1KO mice to use G3P as substrate for oxidation
and backbone for re-esterification. However, severe cold stress and the
concomitant elevated energetic demand may de facto exclude the
metabolic inefficiency connected to the conversion of glucose to G3P.
Consequently, CA UCP1KO mice may provide as little as possible but as
much as required G3P via glycolysis, while the importance of
regenerating G3P through GK activity drastically grows [[310]88]. We
speculate that in this scenario, the majority of glucose is metabolized
to pyruvate and fully oxidized supporting ATP synthesis via oxidative
phosphorylation, and only a minor fraction is converted to G3P.
At this point, it should be mentioned that a few studies indeed
attribute a lower metabolic flexibility and a numerically slightly
higher respiratory quotient to CA UCP1KO mice [[311]28,[312]29]. These
findings may indicate that cold acclimated mice lacking UCP1 have
temporarily higher glucose oxidation rates and that a switch in the
fuel source needs to be controlled even more tightly and carefully
balanced. Thus, we assume that in iBAT of CA UCP1KO mice GDP1-mediated
G3P production only has to cover FAs, which stoichiometrically exceed
the amount of available glycerol backbones provided by lipolysis and GK
as well as LPL activity. This in turn, along with the different depot
sizes, could also explain why CA UCP1KO mice apparently did not
increase the ^2H-enrichment-based lipid cycling rate further. Overall,
we have good reason to believe that in fact true TG/FA cycling activity
in MCA and CA UCP1KO mice may have very likely been much higher.
Addressing the issue of GK activity in different mouse models across
varying ambient temperatures would require the employment of labelled
glycerol and the subsequent detection of the incorporation rate into
TGs. While that would still be within the realm of possibility,
specific quantification of the ATGL-DGAT1-subcycle is close to
impossible, as this would require the use of multiple stable isotope
labels in parallel and extremely sophisticated spectra analysis.
Furthermore, the unknown contribution of GK is a limitation possibly
also affecting the measured in vitro re-esterification rates. Since we
did not determine GK activity in cultured adipocytes, we cannot rule
out a genotype-dependent difference. Thus, calculated cycling rates
based on the release of glycerol and FAs might be skewed. Nevertheless,
the published literature and our own data consistently demonstrated
higher GK expression in UCP1KO BAT and brown adipocytes lacking UCP1
suggesting a higher GK activity, but this remains to be tested.
Moreover, we would like to point out that the mechanistic cell culture
data might not necessarily be transferred directly to the in vivo
situation. Cell culture medium contains high amounts of glucose and
cultured adipocytes have considerable intracellular glycogen and lipid
stores, while there is no extracellular source of FAs, TGs, and
glycerol as in the in vivo situation. In contrast, in mice, a
considerable amount of substrates and metabolites is transported to
iBAT via the blood, whereas intracellular nutrient stores, such as
lipid droplets and in particular glycogen, may be substantially
depleted during prolonged cold exposure. In addition, we are only
looking at a short period (minutes or hours) after acute activation of
TG/FA cycling in the cell model. In the animal model, however, a longer
acclimation period (weeks) is obligatory, and therefore in this case we
are rather studying a chronic process that may have been preceded by
other acute changes. These small differences could nevertheless be
crucial and explain why glucose might have a slightly different
intracellular fate in cultured adipocytes and why ATGL-mediated
lipolysis and glycerol recycling by GK might have a different
importance in cultured brown adipocytes than in iBAT of mice. Thus, the
brown adipocyte cell model helped us to understand the operation of
TG/FA cycling in the context of the intracellular metabolic pathways
involved in thermogenesis. The animal experiments enabled us to
demonstrate the role of TG/FA cycling in BAT in the integrated whole
body response to cold acclimation, i.e. the gradual increase of futile
lipid cycling activity with lowering the acclimation temperature. This
clearly indicates the adaptive nature of TG/FA cycling-based
UCP1-independent thermogenesis in BAT. Its quantitative contribution to
whole-body thermogenesis may be substantial, since it reflects the
oxidative capacity of BAT. Moreover, our results are in agreement with
the notion that the TG/FA cycling-based thermogenesis in BAT may depend
on the inter-organ cycling of FAs including adipose tissues and liver
[[313]17].
Lastly, we want to stress that only male mice were used for the
in vitro studies obviously limiting the translational potential, since
we already know that overall lipoprotein and lipid metabolism is
strongly affected by sex (hormones) and the menstrual cycle [[314]89].
This interesting aspect deserves more future attention, especially
because for the widely studied inbred mouse strains C57BL/6J and
C57BL/6N, males are more susceptible to diet-induced obesity than
females, and just recently sex-specific differences in the browning
propensity of certain adipose tissue depots were reported
[[315]90,[316]91]. Consequently, it would not be entirely implausible
that UCP1-independent energy consuming mechanisms, such as futile
substrate cycles including TG/FA cycling, are enhanced specifically in
female mice, but this remains to be investigated.
Despite these limitations, we could clearly demonstrate that futile
lipid cycling in iBAT is part of adaptive thermogenesis and that this
process possibly in combination with other thermogenic mechanisms is
specifically recruited in the absence of UCP1. Intracellular energy
stores, energy substrates from other adipose tissues and organs, as
well as food-born lipids and carbohydrates are delivered via the
circulation to iBAT and fuel UCP1-independent thermogenesis. Previous
work has already indicated an important role for adipose tissue TG/FA
cycling in enhancing energy expenditure by stimulating ATP turnover
[[317]11,[318][16], [319][17], [320][18],[321]23,[322]92,[323]93]. We
are currently focusing on the question whether this process is even
more complex in vivo and whether it has more unforeseen implications
beyond the proposed thermogenic properties especially in terms of the
dynamic interaction between mitochondria and lipid droplets.
Additionally, further studies addressing the inter-organ part of lipid
cycling and its importance for thermogenesis are needed [[324]19]. In
the future, generation of new mouse models with conditional
tissue-specific deletions of enzymes involved in FA re-esterification
and TG synthesis will enable novel insights into the contribution of
TG/FA cycling to NST, total energy expenditure, and susceptibility to
diet-induced obesity.
Author contributions
J.O. conceptualization, performed experiments, data analysis,
interpretation of data, visualization, supervision, writing - original
draft; P.J. acquired funding, conceptualization, performed experiments,
data analysis, interpretation of data, visualization, supervision;
K.B., O.K., T.G., T.F., S.Schw., and Y.L. conceptualization,
interpretation of data; S.D. conceptualization, performed animal
experiment, interpretation of data; P.G. generated proteome data, data
analysis, interpretation of data; B.K. data analysis, interpretation of
data; S.B., M.S.H. performed experiments; J.E. acquired funding,
conceptualization, interpretation of data; S.Schm. generated electron
micrographs, data analysis, interpretation of data; H.Z.
conceptualization, interpretation of data; K.A. conceptualization,
performed animal experiment, gene expression analysis, data analysis;
R.P. NMR analysis; J.F. extraction of TG for NMR analysis; P.Z.
introduction of the NMR method; J.K. conceptualization, interpretation
of data, supervision, writing - review & editing; M.K. acquired
funding, conceptualization, interpretation of data, supervision,
writing - review & editing.
Acknowledgements