Abstract

   Renal cell carcinoma (RCC) is one of the most prevalent cancers
   diseases in the worldwide. Long noncoding RNAs (LncRNAs) have been
   indicated as a mediator acted in tumorigenesis of RCC. LINC00460 has
   been reported to participate in many kinds of malignancies and promotes
   cancer progressions. However, the mechanism of LINC00460 on RCC is yet
   to be investigated. This study aimed to explore the potential function
   and regulation mechanism of LINC00460 in RCC. We analysed the LINC00460
   expression and the prognosis in RCC patients using Gene Expression
   Profiling Interactive Analysis (GEPIA) and The Cancer Genome Atlas
   (TCGA) databases. LINC00460 level in normal renal cell line and RCC
   cell lines were examined by qRT-PCR. We study the effects of LINC00460
   on proliferation, migration, invasion, apoptosis in RCC cells lines
   using a series of in vivo and in vitro experiments. RNA sequencing
   (RNA-seq) analysis was applied to searching potential LINC00460 related
   signal pathway in RCC. We identified the significant up-regulated
   expression of LINC00460 both in RCC tissues and cell. RCC patients with
   elevated LINC00460 expression have shorter survival. Up-expression of
   LINC00460 promoted cell proliferation, invasion and migration,
   meanwhile down-regulation of LINC00460 exerted inhibitory effect on
   these activities. We crucially identified that LNC00460 promotes
   development of RCC by influencing the PI3K/AKT pathway. Knockdown of
   LNC00460 decreased the phosphorylation of AKT and mTOR. The key finding
   of our study showed that LINC00460 functions as an oncogene in RCC
   pathogenesis by mediating the PI3K/AKT.

   Keywords: RCC, LINC00460, proliferation, metastasis, PI3K/AKT pathway

Introduction

   Renal cell carcinoma (RCC) is a typical malignant carcinoma originating
   from the renal tubules. The morbidity of RCC has been increased over
   the years, only next to prostate cancer and bladder cancer of adult
   cancer diseases [39]^1. When patients in the early phase of kidney
   cancer, the asymptomatic and covert symptoms always caused the
   awareness less of cancer screening, which made the patients often
   missed the diagnosis and treatment correspondingly. When the patients
   were diagnosed, they were already in the advanced clinical stage with
   local progression occurred [40]^2. Radical surgery is still a mainstay
   of treatment for patients in early-stage RCC so far [41]^3. The
   prognosis of RCC patients with advanced stage remains poor although
   progress in treatment has occurred through clinical development, and
   the targeted therapy effect is still limited due to drug resistance and
   adverse reactions [42]^4^, [43]^5. Therefore, unraveling the molecular
   mechanisms of RCC for screening novel biomarkers becomes an immediate
   concern.

   Long noncoding RNAs (LncRNAs) have been considered as transcriptional,
   post-transcriptional or post-translational levels regulators of gene
   expression [44]^6, LncRNAs with more than 200 nucleotides and no
   protein-coding capacity, participate in lots of physiological and
   pathological bio-behaviors [45]^7^, [46]^8, complicating the gene
   regulation networks, such as gene transcription regulation, RNA
   processing, chromatin modification, especially in tumorigenic
   biological activities [47]^9. Accumulating evidences show that LncRNAs
   can caused occurrence of tumor and work as oncogenes [48]^10^-[49]^12.
   Exactly as previous studies, LncRNA MALAT1, LncRNA XIST, LncRNA HOTAIR
   or LncRNA TUG1 facilitate tumor cell growth, migration or invasion in
   multiple types of tumors such as cervical cancer, triple-negative
   breast cancer, gastric cancer, multiple myeloma, pancreatic cancer,
   bladder cancer and thyroid cancer [50]^13^-[51]^17.

   Long intergenic noncoding RNA 460 (LINC00460) is a novel carcinogenic
   LncRNA related in the development of different kinds of human
   malignancies, including lung cancer, thyroid cancer, nasopharyngeal
   carcinoma [52]^10^, [53]^18^, [54]^19. When we found that high
   expression of LINC00460 was associated with poor prognosis in RCC
   patients through TCGA database analysis, which caught our attention to
   study the biofunction of LINC00460 in RCC. Sadly, the more specific
   mechanism of the LINC00460 function in RCC is still unclear.

   The phosphatidylinositol 3-kinase (PI3K)/AKT/mammalian target of
   rapamycin (mTOR) signaling pathway aberrant activation regulated
   cellular processes including proliferation, metabolism, apoptosis and
   metastasis in many cancer types [55]^20^-[56]^22. Study reported that
   PI3K/AKT/mTOR signaling pathway promote human esophageal cancer
   tumorigenesis and metastasis, induce potential cell apoptosis of the
   esophageal squamous cell carcinoma [57]^23. This remarkable pathway is
   regulated by a number of upstream signaling and its cascades downstream
   signaling pathways collaborating with various compensatory effectors
   [58]^24.

   In this study, we analyzed data from the TCGA database using the online
   bioinformatics tool GEPIA and found the increased LINC00460 expression
   level in RCC tissues predicted poor survival of RCC patients. We
   evaluated the level of LINC00460 in RCC cells and its tumorigenesis on
   RCC cell vitality, migration, invasion and apoptosis in vitro and in
   vivo. RNA sequencing (RNA-seq) analysis proved that LINC00460 knockdown
   could mainly affect the genes involved in proliferation and apoptosis.
   In the viewpoint of the mechanism, our results indicated that LINC00460
   mediates PI3K/AKT signaling to promote the progression of RCC cells.
   Thus, this study presented a perspective understanding of RCC
   pathogenesis. We deeply revealed the mechanism of LINC00460 function in
   RCC.

Materials and Methods

Bioinformatical analyses

   The Gene Expression Profiling Interactive Analysis (GEPIA) and The
   Cancer Genome Atlas (TCGA) databases were used to analyzed LINC00460
   expression in RCC and normal tissue. Clinicopathological features
   including overall survival (OS) and disease-free survival (DFS) was
   evaluated linked to RCC patients LINC00460 expression.

Cell Culture

   Human embryo kidney epithelial cell line (HK-2) and renal cell
   carcinoma cell lines were purchased from cell bank of Chinese Academy
   of Sciences. ACHN, 786-O, OSRC-2, Ketr-3, and HK-2 were correspondingly
   cultured in RMPI-1640 or DMEM Medium, supplemented with 10% FBS, 100
   U/mL each penicillin and streptomycin separately. Cell incubated
   condition is 37 °C humidified with 5% CO2.

Cell Transfection

   For over-expressed LINC00460, sequences were constructed into
   pCDH-CMV-MCS-EF1-GreenPuro lentivirus vector (GenePharma Suzhou,
   China). shLINC00460#1 (5'-GCTAAGACCTAATAGCCAATA-3'), shLINC00460#2
   (5'-ACCTTGGTCAAACGTTTAACC-3'), as well as the negative control shCtrl
   (5'-GTTCTCCGAACGTGTACGT-3') were constructed into pLKO.1 (GenePharma
   Suzhou, China) for knockdown of LINC00460. psPAX2, pMD2.G and
   pLKO-shRNA were co-transfected into HEK-293T cells for the lentiviruses
   until 48h later. Stable knockdown ACHN and 786-O cell lines with a
   treatment of 5 μg/mL puromycin for 1 week were obtained after
   lentiviruses infected.

RNA isolate, RT-PCR and qPCR

   We prepared total RNA by using TRIzol Reagent (Invitrogen), synthesized
   cDNA with HiScript Q RT SuperMix for qPCR Kit (Vazyme Biotech).
   Quantitative realtime PCR was performed on ABI-7500 using UltraSYBR
   Mixture Kit (CWBIO Biotech). The primers using for qPCR analysis were
   listed as followed: LINC00460 Forward: ACGCAGTGGATGAGAACGAA, LINC00460
   Reverse: GGGGTGACTTCAGAATGCGT, 18S rRNA Forward: GTAACCCGTTGAACCCCATT,
   18S rRNA Reverse: CCATCCAATCGGTAGTAGCG.

Cell Counting Kit 8 (CCK-8)

   CCK-8 (Beyotime, China) was used to measure cell proliferative
   capacity. 96-well plates planted with transfected cells (5×10^3
   cells/group) were incubated at 37 °C with 5% CO[2] for 24 h, 48 h, 72
   h. 10 µl of CCK-8 solution was added to each cell well at each time
   point and incubate for 2h subsequently. The absorbance at 450 nm of
   each group was tested by the microplate reader.

Transwell Assays

   Firstly, ACHN or 786-O cells were planted into the upper wells of
   chambers (BD Biosciences, USA) coated with or without Matrigel (BD
   Biosciences), then, cultured in a 200 μL FBS-free RMPI-1640 or DMEM
   medium. The lower wells of the chambers containing 390 μL culture
   medium and 10 μL FBS. 24 hours later, removed the medium of the upper
   wells, and fixed cells with 100% methanol and then stained with 0.1%
   crystal violet for 15 min. The stained cells were photographed using an
   Olympus microscope.

Wound Healing Assays

   Gaps in seeded ACHN or 786-O cells were created by a sterilized pipette
   tip. After washing out the debris or the detached cells by PBS, the
   cells were cultured in RMPI-1640 or DMEM for another 24 hours. The
   calculation of wound healing width was using ImageJ Analysis Software.

Flow cytometry

   Flow cytometry (BD, UA) was used to examine cell apoptosis. No
   stimulation was given to RCC cells to produce apoptosis. EDTA-free
   trypsin digested 786-O and ACHN cells. Then, the cells were suspended
   in 1× binding buffer at 3×10^6/mL. Subsequently, 100 μL of cells were
   moderately filled with each of 5 μL of APC and PI, followed by
   incubation with no light for 5 min at room temperature. Cell apoptosis
   was analyzed using the flow cytometer. The number of Annexin-APC
   positive cells represented cell apoptosis rate analyzed by FlowJo
   v10.6.2 software.

Western Blot

   The total content of cellular protein harvested from RCC cells were
   extracted using RIPA lysis buffer (Keygen, Nanjing, China) and the
   protein amounts was determined using a BCA kit (Keygen, Nanjing,
   China). SDS-PAGE separated same volumes proteins of each lane, then
   blotted onto PVDF membranes. Primary antibodies were incubated
   overnight at 4 °C, and HRP-labeled secondary antibody (ABclonal,
   1:5,000) 2 hours at RT after blocked with 5% BSA. Signal of
   immunoreactivities were photographed by ECL reagent (NCM Bio, China) on
   Tanon 5200 automatic chemiluminescence imaging system (Tanon, China).
   Antibody listed as follow: Anti-E-cadherin (BD Biosciences, 610181),
   Anti-Vimentin (Proteintech, 10366-1-AP), Anti-N-cadherin (BD
   Biosciences, 610920), Anti-PI3k (Proteintech, 67121-1-Ig), Anti-AKT
   (Proteintech, 101762-2-AP), Anti-p-AKT (Proteintech, 66444-1-Ig),
   Anti-p-mTOR (Cell Signaling Technology, 5536S), Anti-Bcl-2 (Cell
   Signaling Technology, 155071S), Anti-Cleved-Caspaes 9 (Cell Signaling
   Technology, 20750S), Anti-p53 (Proteintech, 10442-1-AP), and we took
   GAPDH(Santa Cruz, sc-32233) as control.

Animal Works

   We used BALB/c mice (Vital River Laboratory Animal Technology. China)
   for research. We subcutaneously injected 786-O cells (5×10^6) of each
   group (shCtrl and shLINC00460) into the two side of mice. When tumors
   were visible, we recorded xenograft tumors volume (V) every 3 days by
   metering the long axis (L) and the short axis (W), and calculated the
   tumors' growth rate with the equation: V = (L × W2)/2. By day 27, the
   xenograft tumor tissues were harvested, weighed, photographed and
   subjected to subsequent analysis.

   Meanwhile, shCtrl and shLINC00460 786-O-Luc cells (3 × 10^6) were
   injected intravenously via the mice tail vein. Bioluminescence images
   were filmed after 6 weeks (Night OWL II LB983; Berthold Technologies).
   Animal Care and Use Committee and Ethics Committee of Xuzhou Medical
   University approved all animal experiments.

Statistical Analysis

   All collected data were analyzed using Statistical Product and Service
   Solutions (SPSS 23.0) (IBM, USA) and presented in form of mean ±
   standard deviation. Student's t-test were used to tested the
   differences between two groups. Comparison among three groups was
   analyzed using One-way ANOVA test. p<0.05 suggested statistically
   significant differences.

Results

LINC00460 expression was elevated and closely linked to poor prognosis in RCC

   GEPIA database with TCGA datasets were used to obtain LINC00460
   expression in RCC tumor tissues paired with normal tissues and the
   survival of RCC patients. GEPIA with TCGA database revealed that
   LINC00460 was higher level both in Kidney renal clear cell carcinoma
   (KIRP) and Kidney renal papillary cell carcinoma (KIRP) (Fig. [59]1A,
   1B). In addition, clinicopathological staging are important prognostic
   factors for RCC patients, we investigated the LINC00460 expression
   patterns in different clinical pathological grade of RCC in GEPIA
   database, we identified a gradual increase in the expression of
   LINC00460 with the RCC pathological progression (Fig. [60]1C).
   Furthermore, RCC patients with high expression of LINC00460 exhibited a
   shorter OS and DFS than those with low expression of LINC00460 (Fig.
   [61]1D, 1E). The results indicated that aberrant expression of
   LINC00460 might be strongly associated with poor prognosis in RCC.

Figure 1.

   [62]Figure 1
   [63]Open in a new tab

   Expression of LINC00460 in RCC tissues based on the data from the GEPIA
   and TCGA. (A, B) Expression level of LINC00460 in KIRP tissues (n=286)
   and normal tissues (n=60), KIRC tissues (n=523) and normal tissues
   (n=100), analyzed in TGCA database (fold change>2.0, * p<0.05). (C)
   LINC00460 was gradually elevated with advanced staging in RCC. (D, E)
   OS and DFS rate of RCC patients with lowly or highly LINC00460 analyzed
   using the Kaplan-Meier analyses and log-rank test.

LINC00460 was elevated in RCC cell Lines and promoted cell proliferation

   We detect the expression of LINC00460 in RCC cells to explore the
   effect of LINC00460 on RCC progression. qRT-PCR analysis demonstrated
   that LINC00460 was significantly upregulated in RCC cell lines compared
   with normal renal cell (Fig. [64]2A). Subsequently, qRT-PCR was used to
   measure the LINC00460 expression level after different transfection
   applied to the cells, and the results showed that LINC00460 was
   significantly upregulated in cells transfected with LINC00460
   overexpression vector (Fig. [65]2B), while LINC00460 was remarkably
   downregulated in cells transfected with the pLKO.1-shRNA, compared with
   the control vector group (Fig. [66]2C). Next, we tested cell
   proliferation by CCK-8 assay. The data of CCK-8 revealed that
   upregulated LINC00460 expression increased cell proliferation as
   relative to the control groups (Fig. [67]2D), while downregulated
   LINC00460 expression suppressed cell proliferation (Fig. [68]2E).

Figure 2.

   [69]Figure 2
   [70]Open in a new tab

   LINC00460 expression level in RCC cell lines and effects on cell
   proliferation. (A) Expression patterns of LINC00460 in RCC cell lines
   and normal renal cell lines detected by qRT-PCR (*** p<0.001). (B, C)
   Expression patterns of LINC00460 in RCC cells treated with
   over-expressed or silenced LINC00460 detected by qRT-PCR (*** p<0.001).
   (D, E) CCK-8 assay of ACHN and 786-O cells transfected with
   over-expressed or silenced LINC00460 (*** p<0.001).

LINC00460 facilitated RCC cell migration, invasion and induced EMT phenotype
in vitro

   In transwell assays, we showed that LINC00460 overexpression enhanced
   ACHN and 786-O cells migration and invasion (Fig. [71]3A, 3C),
   LINC00460 knockdown inhibited migration and invasion of ACHN and 786-O
   cells (Fig. [72]3B, 3D). We conformed the same results that LINC00460
   overexpression enhanced cell migration by wound healing assays (Fig.
   [73]3E, 3G), while LINC00460 knockdown suppressed cell migration (Fig.
   [74]3F, 3H) respectively.

Figure 3.

   [75]Figure 3
   [76]Open in a new tab

   LINC00460 facilitated RCC cells migration, invasion in vitro. (A, B, C,
   D) The cell migration and invasion abilities of ACHN and 786-O cells
   transfected with overexpressed or silenced LINC00460 were determined by
   Transwell assays (*** p<0.001). (E, F, G, H) Wound healing assay was
   performed to examine the effect of LINC00460 overexpression or
   knockdown on ACHN and 786-O cells migration (* p<0.05, *** p<0.001).
   (I, J) EMT markers was detected by Western blot analysis when silenced
   LINC00460 was transfected in RCC cells. Data statistics was also shown
   (GAPDH as negative control, *p < 0.05, *** p<0.001).

   We detect the expression of EMT-related proteins inevitably, as the
   outcome obtained from Western blot analysis (Fig. [77]3I, 3J).
   Knockdown of LINC00460 increased the levels of EMT marker E-cadherin
   and decreased N-cadherin and Vimentin protein levels in ACHN cells.
   Consistent with the results, we can make the conclusion that LINC00460
   could accelerate the invasion, migration and induced EMT progress of
   RCC cells.

LINC00460 affected the apoptosis of RCC cells

   Flow cytometry and Western blot assay were associated to verify whether
   promotion of cell malignant progress by LINC00460 was associated with
   cell apoptosis. Compared with shCtrl group, apoptotic cells were
   decreased in the LINC00460 over-expressed ACHN or 786-O cells (Fig.
   [78]4A, 4B). Anti-apoptotic protein Bcl-2 was diminished after
   LINC00460 knockdown, conversely, pro-apoptotic protein Cleaved
   Caspase-9 and p53 expression were increased in ACHN cells (Fig. [79]4C,
   4D). All of these results proved that LINC00460 affects the malignant
   progression of RCC cells by affecting apoptosis.

Figure 4.

   [80]Figure 4
   [81]Open in a new tab

   Influence of LINC00460 on RCC cells apoptosis and EMT phenotype. (A, B)
   Cell apoptosis was determined using flow cytometry analysis after
   LINC00460 overexpression in RCC cell lines (** p<0.01). (C, D) Cell
   apoptosis markers were detected by Western blot analysis when silenced
   LINC00460 was transfected in RCC cells. Data statistics was also shown
   (GAPDH as negative control, *p < 0.05, *** p<0.001).

LINC00460 promoted RCC cell growth and metastasis in vivo

   For the assessment of LINC00460 influence on tumor growth in vivo, nude
   mice were injected subcutaneously with transfected 786-O cells.
   Knockdown of LINC00460 noticeable suppressed proliferation of tumor
   cells (Fig. [82]5A), as presented by the markedly reduced tumor volume,
   size and weights in the knockdown group (Fig. [83]5B, 5C). Furthermore,
   the qRT-PCR results confirmed that the significantly lower level of
   LINC00460 in shLINC00460-treated groups of xenograft tumor tissues
   compared with shCtrl groups (Fig. [84]5D).

Figure 5.

   [85]Figure 5
   [86]Open in a new tab

   LINC00460 promoted RCC cells growth and metastasis in vivo. (A) 786-O
   cells were injected into nude mice after the transfection of
   shLINC00460 and shCtrl vector. (B) The growth curves of tumors from
   subcutaneously injected nude mice treated with shLINC00460 or shCtrl
   (*** p<0.001). (C) The weights of tumors from subcutaneously injected
   nude mice treated with shLINC00460 or shCtrl (* p<0.05). (D) The levels
   of LINC00460 expression in paired tumor tissues formed from
   subcutaneously injected nude mice treated with shLINC00460 or shCtrl,
   determined by qRT-PCR (*** p<0.001). (E) Representative bioluminescence
   images and statistical analysis of lung metastases in mice via tail
   vein injection of indicated cells (**p < 0.01, ***p < 0.001). (F)
   Representative H&E images and statistical analysis of resected lung
   xenografts with metastatic loci (*** p < 0.001).

   To further evaluate LINC00460 knockdown could produce inhibition effect
   on metastasis in vivo, we administered tail vein injections with
   786-O-Luc cells stably transduced shLINC00460 or shCtrl vector into two
   groups of mice each respectively. Six weeks after tail vein injections,
   we used bioluminescence photograph system to assess the metastatic
   nodules formed on the lung surfaces of mice. Group with LINC00460
   knockdown cells formed a smaller number of metastatic foci in lungs
   than the control group (Fig. [87]5E, 5F). Overall, the data
   demonstrated that LINC00460 downregulated could inhibit RCC cell growth
   and metastasis in vivo.

Dysregulation of LINC00460 was related to PI3K/AKT pathway

   To explore more particular details about the LINC00460 involved pathway
   in RCC, RNA-seq was processed after LINC00460 knockdown in 786-O cells
   (Fig. [88]6A). To get further investigation of LINC00460 worked in RCC,
   Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment
   analysis was conducted for looking the target genes of LINC00460 (>1.5
   fold change). KEGG pathway clustering indicated that the significantly
   over-represented biological pathways mapping in cell motility, cell
   growth and death, cell repair and replication. Markedly, the
   dysregulated key genes that were related to the PI3K/AKT pathways (Fig.
   [89]6B).

Figure 6.

   [90]Figure 6
   [91]Open in a new tab

   Effect of LINC00460 knockdown on activation of PI3K/AKT pathway in RCC
   cell lines. (A) Hierarchically clustered heatmap of the upregulated and
   downregulated genes in 786-O cells after shLINC00460 and shCtrl
   transfections. (B) Pathway classification of differentially expressed
   genes (DEGs). Bubble plots represented the number of DEGs, x axis
   represented rich factor, y axis represented the functional
   classification of KEGG. (C, D, E, F) The Western blot assay was used to
   detect PI3K, AKT, p-AKT, mTOR and p-mTOR expression in cells
   transfection with shLINC00460 or overexpressed LINC00460 as relative to
   the control groups. (GAPDH as negative control, *p < 0.05, ***
   p<0.001).

   PI3K/AKT pathway was involved in different cancer cell behaviors,
   especially cell proliferation and apoptosis [92]^25. Thus, we
   investigated whether LINC00460 control cancer cell progress by the
   PI3K/AKT pathway. The Western blot assay revealed a reduction of PI3K,
   p-AKT and p-mTOR expression in ANCH and 786-O cells transfected with
   shLINC00460 as relative to the control groups. Meanwhile, the
   expression of PI3K, p-AKT and p-mTOR were increased in cells
   transfected with overexpressed LINC00460 compared with the control
   groups (Fig. [93]6C-F). These results suggested that dysregulation of
   LINC00460 could regulate the PI3K/AKT pathway.

Discussion

   Renal cell carcinoma (RCC) is a heterogenous cancer consisting of
   various different subtypes [94]^26, and considered as a stepwise
   process involving the accumulation of multiple genetic and epigenetic
   alterations [95]^27. The most critical biological characteristics of
   RCC are uncontrolled cellular proliferation, abnormal apoptosis and
   metastasis, which are the leading cause of mortality [96]^28.
   Unfortunately, many patients have been in advanced RCC stage when
   diagnosed due to no effective diagnosis biomarker and a poor
   understanding of the mechanism.

   To date, LncRNAs have been known as active biological marker in cancer
   diagnosis rather than transcriptional noise [97]^29. They were proved
   to play pivotal roles in carcinogenesis via regulating various
   important cellular biological behavior, including proliferation,
   apoptosis, angiogenesis, invasion and metastasis [98]^30. In cervical
   cancer, upregulation of LncRNA ZEB1-AS1 enhances cell epithelial to
   mesenchymal transition by elevating ZEB1 level [99]^31. LncRNA UCA1 is
   increased in thyroid cancer and represses cell proliferation and cell
   invasion by interacting with miR-204/IGFBP5 [100]^32. LncRNA CA3-AS1
   restraint of colorectal cancer cell vital, invasion by miR-93/PTEN axis
   [101]^33. The downregulation of LINC00152 suppresses the development of
   gastric cancer through controlling miR-193b-3p [102]^34. To our
   knowledge, LINC00460 has been reported to participate in many kinds of
   malignancies and promotes cancer progressions.

   In the present research, LINC00460 have been proved overexpressed in
   RCC according to the TCGA analysis of clinical specimens, higher
   LINC00460 expression level was correlated with poor OS and DFS and
   advanced clinicopathological staging in RCC patients, which is key
   finding of prognostic significance of LINC00460 for RCC patients. Our
   work is the initial presentation of LINC00460 biologic function,
   correlated with progress of RCC cells. A series of assays In vitro and
   in vivo revealed that LINC00460 over-expression enhanced cell
   proliferation, migration, and invasion, while its down-regulation
   suppressed tumor growth and reduced cell migration and invasion. Flow
   cytometry assays showed that overexpressed LINC00460 inhibited
   apoptosis in RCC cells. To routinely and precisely unravel the pathways
   that were related to the function of LINC00460 in tumorigenesis of RCC,
   RNA-seq and date analysis was conducted, and PI3K/AKT pathway was found
   to be regulated by LINC00460. Then we confirmed this finding via
   Western blot assays. These findings indicate that LINC00460 plays an
   oncogenic role in RCC development and is potential prognostic marker
   for RCC patients.

   Emerging studies have identified that the PI3K/AKT signaling pathway
   influences various pathophysiological progress that associated with
   cancer phenotypes, such as cell apoptosis and cell proliferation
   [103]^35^-[104]^40. PI3K activation phosphorylates AKT and active AKT
   can lead to a number of downstream effects including the activation of
   mTOR, also in the form of phosphorylates mTOR, which in turn directly
   impacts cell growth and survival [105]^41^-[106]^43. The crucial
   influence of the activation of AKT is the increasing cell viability
   [107]^44, and involved in cellular tumorigenicity behaviors such as
   proliferation, metastasis, invasion, migration, and angiogenesis
   [108]^45^, [109]^46. Therefore, in accordance with our RNA-seq data
   analysis, we found that the knockdown of LINC00460 downregulated the
   expression of p-mTOR, p-AKT and PI3K, confirmed our hypothesis that
   LINC00460 might act as one upstream of PI3K/AKT pathway to control RCC
   progression. Furthermore, our findings displayed in Western blot assay
   indicating that LINC00460 could promote tumor migration and invasion
   via EMT.

Conclusions

   In conclusion, our findings illustrated that LINC00460 expression was
   strongly upregulated in RCC tissues and cells, consequently, its higher
   expression might be associated with poor clinical prognosis in RCC
   patients, which enables it as an attractive prognostic factor for RCC.
   LINC00460 influenced tumor growth, metastasis and apoptosis in vitro
   and in vivo. In the aspect of signaling pathway, LINV00460 activating
   the PI3K/AKT pathway. Our findings might display a novel insight into
   the mechanism of LINC00460 in RCC. The mechanism about LINC00406 how to
   regulate PI3K/AKT signaling pathway are still needed our further study
   to verify. Further clinical experiments are still needed to verify.

Acknowledgments