Abstract

Simple Summary

   Pancreatic adenocarcinoma (PAAD) is a highly malignant tumor with a
   poor prognosis and lack of effective biomarkers. We demonstrated, using
   bioinformatics analyses, that the leucine-rich repeat-containing 8A
   (LRRC8A) can affect the prognosis of patients with PAAD. In addition,
   experiments in vitro showed shRNA of LRRC8A can significantly affect
   the hallmarks of PAAD, including cell proliferation, cell migration,
   drug resistance, and immune infiltration. Collectively, our data
   suggest that LRRC8A could be a promising prognostic biomarker and
   therapeutic target for PAAD.

Abstract

   Pancreatic adenocarcinoma (PAAD) is a highly malignant tumor of the
   digestive system with increasing morbidity and mortality. The lack of
   sensitive and reliable biomarkers is one of the main reasons for the
   poor prognosis. Volume-regulated anion channels (VRAC), which are
   ubiquitously expressed in the vertebrate cell membrane, are composed of
   leucine-rich repeat-containing 8A (LRRC8A) and four other homologous
   family members (LRRC8B–E). VRAC heterogeneous complex is implicated in
   each of the six “hallmarks of cancer” and represents a novel
   therapeutic target for cancer. In this study, LRRC8A was speculated to
   be a promising prognostic biomarker and therapeutic target for PAAD
   based on a series of bioinformatics analyses. Additional cell
   experiments and immunohistochemical assays demonstrated that LRRC8A can
   affect the prognosis of PAAD and is correlated to cell proliferation,
   cell migration, drug resistance, and immune infiltration. Functional
   analysis indicated that LRRC8A influences the progression and prognosis
   of patients with PAAD by the regulation of CD8^+ T cells immune
   infiltration. Taken together, these results can help in the design of
   new therapeutic drugs for patients with PAAD.

   Keywords: pancreatic adenocarcinoma (PAAD), bioinformatics analyses,
   leucine-rich repeat-containing protein 8A (LRRC8A), immune infiltration

1. Introduction

   Pancreatic adenocarcinoma (PAAD) is a deadly malignant tumor, with a
   5-year survival rate of only 2–9%. It is the fourth leading cause of
   cancer-associated mortality [[40]1,[41]2]. Most patients with PAAD
   remain asymptomatic during the initial stage of cancer development
   until they progress to advanced metastasis, wherein tumor cells become
   highly invasive [[42]3]. The lack of sensitive and reliable biomarkers
   is one of the main reasons for its poor prognosis. Although the
   application of carbohydrate antigen (CA) 19-9, which is the primary
   biomarker used at present for PAAD has witnessed incremental progress
   in the diagnosis of PAAD, it has a limitation that cannot be
   overlooked, wherein CA19-9 showed false-positive results in patients
   with chronic pancreatitis, cholangitis, and other diseases [[43]4].
   Several novel biomarkers, including HOX antisense intergenic RNA (a
   type of long non-coding RNA), C4b binding protein alpha, micro-RNA, and
   exosomes have been identified as potential PAAD biomarkers, but these
   markers cannot guarantee high reliability, sensitivity, and specificity
   owing to some inherent limitations, such as inadequate quantities of
   micro RNA in various biofluids [[44]5,[45]6,[46]7]. Another challenge
   in the treatment of PAAD is the complex tumor microenvironment,
   including the presence of tumor-associated macrophages and regulatory T
   cells within the stroma that create a barrier for conventional
   therapies and immunotherapies [[47]8]. Although numerous clinical
   trials targeting the stroma have been conducted, most of them did not
   provide the expected efficacy based on preclinical studies
   [[48]9,[49]10]. Therefore, identifying novel biomarkers to predict the
   prognosis of PAAD and developing effective therapeutic targets are
   required for the treatment of PAAD.

   Volume-regulated anion channels (VRACs), also called volume-sensitive
   outwardly rectifying anion channels, are ubiquitously expressed in the
   membrane of vertebrate cells. Swelling-activated chloride currents are
   activated when VRACs are opened. Leucine-rich repeat-containing 8A
   (LRRC8A) and four other homologous family members (LRRC8B–E) assemble
   into VRAC complexes. Since these proteins can exist in a soluble form
   and as an integral membrane protein, cyst fluid sampling and testing
   for LRRC8A and its homologous family proteins are feasible using mass
   spectroscopy. This would provide a potential opportunity for early
   detection and management [[50]11]. Moreover, as the main chloride
   channel type, VRAC is implicated in each of the six “hallmarks of
   cancer” and represents an emerging therapeutic target for cancer
   [[51]12,[52]13,[53]14]. A dysregulated expression or dysfunction of
   VRAC can be detected in many cancer types, indicating a correlation
   between ion channels and tumorigenesis [[54]15]. LRRC8A downregulation
   can reportedly increase the sensitivity of glioblastoma to temozolomide
   and carmustine [[55]16]. LRRC8A can regulate the proliferation and
   metastasis of colorectal cancer, hepatocellular carcinoma, and
   nasopharyngeal carcinoma [[56]16,[57]17,[58]18,[59]19]. Recent studies
   also supported the finding that LRRC8D and LRRC8A/LRRC8E play an
   integral role in the regulation of multidrug resistance and tumor
   immunotherapy, respectively [[60]20]. Previous studies confirmed the
   role of calcium-activated chloride channel regulator 1 as a potential
   suppressor and independent factor in PAAD [[61]21]; however, there are
   no data regarding the prognostic role of VRAC in PAAD.

   In this study, a series of bioinformatics analyses based on several
   large public databases were conducted, and LRRC8A was identified as a
   possible potent therapeutic target and prognostic biomarker for PAAD
   based on cell experiments. Additional functional analysis, immune
   infiltration analysis, and immunohistochemical assay indicated that
   LRRC8A influences the progression and prognosis of PAAD by the
   regulation of CD8^+ T cells immune infiltration.

2. Materials and Methods

2.1. Pan-Cancer Analysis of LRRC8A-8E Expression by ONCOMINE

   The mRNA expression of LRRC8A, LRRC8B, LRRC8C, LRRC8D, and LRRC8E in
   different human cancer types was analyzed using ONCOMINE
   ([62]www.oncomine.org (accessed on 11 June 2021)). A p-value of 0.05
   and fold change of 2 were set as significance thresholds.

2.2. LRRC8A–8E Expression in PAAD by GEPIA and UALCAN

   The transcriptional levels of LRRC8A–8E in PAAD were thoroughly and
   comprehensively analyzed using GEPIA ([63]http://gepia.cancer-pku.cn/
   (accessed on 27 July 2021)) and UALCAN
   ([64]http://ualcan.path.uab.edu/analysis.html (accessed on 27 July
   2021)). The expression data of tumor samples (n = 179) and normal
   samples (n = 171) in GEPIA were acquired from the Cancer Genome Atlas
   (TCGA) and the Genotype-Tissue Expression. Each box plot of LRRC8A–8E
   in PAAD was designed using the “Expression DIY” module of GEPIA. The
   expression levels of LRRC8A–8E based on individual cancer stages in
   PAAD were analyzed using the TCGA dataset in UALCAN. p < 0.05 was set
   as a significance threshold.

2.3. Survival Analysis Using Kaplan–Meier Plotter and GEPIA

   The correlation between LRRC8A–8E expression and clinical outcomes of
   PAAD was assessed using a Kaplan–Meier Plotter
   ([65]https://kmplot.com/analysis/ (accessed on 7 January 2022)) and the
   module of survival analysis in GEPIA. The Kaplan–Meier plotter can
   assess the overall survival (OS) and relapse-free survival (RFS) of
   patients with PAAD (n = 177), whereas the OS and disease-free survival
   (DFS) analysis of PAAD can be obtained using GEPIA (n = 178).

2.4. Functional Analysis of LRRC8A–8E in Patients with PAAD

   The co-expression and network module of LRRC8A–E in patients with PAAD
   were analyzed using cBioPortal ([66]www.cbioportal.org (accessed on 27
   July 2021)), which included 11 studies with 1347 PAAD samples. The Gene
   Ontology (GO) enrichment heatmap and the Kyoto Encyclopedia of Genes
   and Genomes (KEGG) pathway analysis of the top 50 genes positively
   associated with LRRC8A were performed using OmicShare tools, which is a
   free online platform for data analysis ([67]https://www.omicshare.com
   (accessed on 25 April 2022)). The protein–protein interaction
   (PP—network of LRRC8A–E was analyzed using the Search Tool for
   Retrieval of Interacting Genes/Proteins ([68]https://string-db.org/
   (accessed on 23 July 2021)) and GeneMANIA ([69]http://www.genemania.org
   (accessed on 27 July 2021)).

2.5. Correlations between LRRC8A–E Expression and Immune Infiltration Using
Tumor Immune Estimation Resource (TIMER)

   GEPIA databases and TIMER ([70]http://cistrome.org/TIMER/ (accessed on
   28 July 2021)) were used to determine the relationship between LRRC8A–E
   expression and immune infiltration. The TIMER database contains 10,897
   samples across 32 cancer types from TCGA to allow the evaluation of the
   abundance of immune infiltration.

2.6. Cell Lines

   PAAD cell lines PANC1 (CRL-1469™), AsPC-1 (CRL-1682™), and BxPC-3
   (CRL-1687) were obtained from the American Type Culture Collection
   (USA), AsPC-1^GEM-R cell line (gemcitabine-resistant AsPC-1) was
   established in our laboratory, which can grow in the medium containing
   18 μg/mL gemcitabine for more than 4 days. All cell lines were cultured
   in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal
   bovine serum. Mycoplasma was detected and determined to be negative.

2.7. Immunochemistry (IHC) Analysis

   PAAD tissues were obtained from the Department of Pathology of Xijing
   Hospital, and patient consent was reviewed and approved by the Xijing
   Hospital Clinical Research Ethics Board (certificate number KY2015432).
   Based on standard protocols [[71]22], IHC analysis was performed using
   antibodies such as LRRC8A (Biobyt, Cambridge, United Kingdom;
   orb185053) and CD8 (Proteintech, Rosemont, IL, USA; 66868-1-Ig). The
   area of positive cells, average optical density values, and integrated
   optical density values were calculated using Image-Pro Plus analysis
   software 2020 to evaluate the immunohistochemical results. The R
   software (version 4.1.0) was used to linearly fit the
   immunohistochemical quantification data and the function Cook’s
   distance was used for data visualization.

2.8. Real-Time Polymerase Chain Reaction (PCR) Assays

   Real-time PCR was performed using a PrimeScript™ RT Reagent Kit and TB
   Green^® Fast qPCR Mix purchased from Takara (Beijing, China) using a
   Step One Plus real-time PCR Detection System (Applied Biosystems,
   Thermo Fisher, Waltham, MA, USA). Relative mRNA expression levels were
   calculated using the 2^−ΔΔCT method, and β-actin mRNA expression was
   set as the internal reference. The sequences of primers used for PCR
   are shown in [72]Table 1.

Table 1.

   Primer sequences for Real-time PCR.
   Gene Name      Sequences (5′ to 3′)
   LRRC8A FORWARD GGAGAGCAGCTACAGCGACA
   LRRC8A REVERSE TCACTCACCTCCGACAGGAA
   EPHA2 FORWARD  AGAAGCGCCTGTTCACCAAG
   EPHA2 REVERSE  GCTCCTCCACGTTCAGCTTC
   ACTIN FORWARD  CATGTACGTTGCTATCCAGGC
   ACTIN REVERSE  CTCCTTAATGTCACGCACGAT
   [73]Open in a new tab

2.9. Western Blotting Analysis

   Western blotting analyses were performed using standard protocols
   [[74]23]. Antibodies against the following proteins were used: LRRC8A
   (Biobyt, orb185053) and β-actin (Engibody, Dover, DE, USA; AT0001). A
   grayscale value of western blotting was obtained using the Image J
   software 2020 and analyzed using the GraphPad Prism 6 software.

2.10. LRRC8A Knockdown

   The knockdown of LRRC8A was accomplished by employing short hairpin
   (shRNA) lentivirus (sense: CCGUCUACUACGUGCACAATT, antisense:
   UUGUGCACGUAGUAGACGGTT) (Hanbio, Shanghai, China) infection as reported
   previously [[75]24], and this was verified by real-time PCR and western
   blotting analysis.

2.11. Cell Viability Assay

   Cells were seeded in a 96-well plate and pretreated with 10 μM
   4-(2-Butyl-6, 7-dichloro-2-cyclopentyl-indan-1-on-5-yl) oxobutyric acid
   (DCPIB), a kind of specific VRAC inhibitor. Then, the cells were
   treated with 100 μM gemcitabine, and cell viability was detected at
   different times using a Cell Counting Kit-8 (CCK-8) (Solarbio, Beijing,
   China; CA1210).

2.12. Wound Healing Assay

   AsPC-1 and BxPC-3 cells were seeded in a six-well plate and infected
   with ShRNA lentivirus of LRRC8A. When the cells reached approximately
   80% confluence, a pipette tip was used to create a straight line in the
   middle of the plate. Then, the shed cells were rinsed using
   phosphate-buffered saline, and a serum-free medium was added. Images of
   the straight line at 0 h and 48 h were captured, and the relative
   migration distance was analyzed to elucidate the scribing process of
   the cells. AsPC-1 and BxPC-3 cells infected with scramble shRNA
   lentivirus were used as the negative control.

2.13. Transwell Assay

   AsPC-1 and BxPC-3 cells with knocked-down LRRC8A were added to the
   chamber and cultured for 48 h. Then, the cells were treated with 4%
   paraformaldehyde and stained with crystal violet. Images of cells that
   passed through the chamber were captured under a microscope.

2.14. Statistical Analysis

   All data are presented as means ± standard error of the mean and
   analyzed using the GraphPad Prism 6 software. The significance was
   analyzed using Student’s t-tests. p < 0.05 was considered statistically
   significant.

3. Results

3.1. LRRC8A Is Highly Expressed in PAAD in Pan-Cancer Analysis

   The expression of LRRC8A and four other homologous family members
   (LRRC8B–E) in pan-cancer was retrieved using the ONCOMINE database
   ([76]Figure 1a). Results revealed that LRRC8A expression was higher in
   PAAD samples than in normal samples. To further evaluate its expression
   in PAAD, GEPIA, and UALCAN were used. As shown in [77]Figure 1b, the
   transcripts per million expression level of LRRC8A in PAAD samples was
   seven folds higher than that in normal samples (46.52 in tumor samples
   vs. 6.59 in normal samples). Subsequently, an in-depth analysis by
   UALCAN demonstrated a significant correlation between LRRC8A expression
   (p * < 0.05) and the pathological stage of patients with PAAD
   ([78]Figure 1c). The expression of LRRC8B–8E in different pathological
   stages of PAAD is shown in [79]Supplementary Figure S1a,b.

Figure 1.

   [80]Figure 1
   [81]Open in a new tab

   Bioinformatics analyses of LRRC8A in PAAD. (a) Pan-cancer analysis of
   LRRC8A–E expression by ONCOMINE; (b) the expression of LRRC8A in PAAD
   was seven-fold higher than that in normal by GEPIA, Tumor (n = 179),
   Normal (n = 171); (c) LRRC8A expression in PAAD based on individual
   cancer stages; (d,e) the DFS and OS of patients with PAAD with a high
   LRRC8A expression were significantly worse than those with a low LRRC8A
   expression; (f) the RFS of patients with PAAD with a high LRRC8A
   expression were significantly worse than those with a low LRRC8A
   expression.

3.2. LRRC8A Expression Is Associated with Poor Prognosis in Patients with
PAAD

   To evaluate the value of differentially expressed LRRC8A–E in the
   progression of PAAD, its correlation with clinical outcomes was
   assessed using GEPIA (n = 178) and Kaplan–Meier plotter (n = 177).
   Using GEPIA, the DFS (LOGRANK test, p = 0.0052; hazards ratio (HR), 1.9
   (high); p (HR) = 0.006) and OS rates (logrank test, p = 0.017; HR, 1.7
   (high); p (HR) = 0.018) of patients with PAAD with a high LRRC8A
   expression were significantly worse than those with a low LRRC8A
   expression ([82]Figure 1d,e). Similarly, the RFS of patients with PAAD
   using a Kaplan–Meier plotter also indicated that LRRC8A was a
   detrimental prognostic factor of PAAD (RFS: HR, 4.13, 95% CI,
   1.6–10.69; logrank p = 0.0016) ([83]Figure 1f). The correlation of
   LRRC8B–8E with clinical outcomes of PAAD is shown in [84]Supplementary
   Figure S1.

3.3. Identification of the Role of LRRC8A in PAAD In Vitro

   As mentioned above, uncontrolled proliferation, frequent migration, and
   multidrug resistance are the fundamental hallmarks of cancer cells. A
   gemcitabine-resistant AsPC-1^GEMR cell line was established to
   investigate whether LRRC8A was involved in the drug resistance of PAAD
   ([85]Figure 2a). The CCK-8 assay results revealed that the knockdown of
   LRRC8A using shRNA or DCPIB, the specific VRAC inhibitor can inhibit
   the proliferation of PAAD cells and increase their sensitivity to
   gemcitabine ([86]Figure 2b, [87]Supplementary Figure S1d).
   Additionally, qRT-PCR and western blot results showed LRRC8A decreased
   after AsPC-1^GEMR cells were pretreated with DCPIB ([88]Supplementary
   Figure S1d) and the knockdown effect of shLRRC8A in PAAD cell lines was
   showed in [89]Supplementary Figure S1e.

Figure 2.

   [90]Figure 2
   [91]Open in a new tab

   Roles of LRRC8A in PAAD in vitro. (a) Cell viability of AsPC-1 and
   AsPC-1^GEMR cells on GEM; (b) cell viability of AsPC-1^GEMR cells on
   GEM after pretreated with shLRRC8A or scramble lentivirus (NC); (c)
   mRNA expression of LRRC8A in PAAD cell lines; (d) LRRC8A protein
   expression in PAAD cell lines; (e) representative immunohistochemical
   results of LRRC8A in patients with PAAD and quantitative analysis
   results; (f) wound healing assay using BxPC-3 cells and AsPC-1^GEM-R
   cells with LRRC8A knockdown and quantitative analysis results; (g)
   transwell experiments using AsPC-1 and BxPC-3 cells, and quantitative
   analysis results; (h) expression of LRRC8A and MMP2 after AsPC-1,
   AsPC-1^GEM-R and BxPC-3 cells were treated by shLRRC8A. Error bars
   indicate SE. * p < 0.05, ** p < 0.01 and *** p < 0.001 by Student’s
   t-tests. The whole western blots were shown in [92]File S1. ns: not
   significant.

   To evaluate the potential role of LRRC8A in PAAD, qRT-PCR and western
   blotting were used to detect the expression of LRRC8A in PAAD cell
   lines AsPC-1, PaNC-1, and BxPC-3. The sequence of cell migration and
   invasion capacity, angiogenic potential, and tumorigenicity was
   reportedly BxPC-3 > AsPC-1 > PaNC-1 [[93]25]. A similar mRNA and
   protein expression gradient of LRRC8A in PAAD cell lines was also
   observed in [94]Figure 2c,d, respectively. The immunohistochemical
   analysis of pathological sections obtained from patients with PAAD
   demonstrated that a high LRRC8A expression was correlated to the tumor
   grade of PAAD ([95]Figure 2e). To investigate whether LRRC8A affects
   the migration and invasion abilities of PAAD cells, a wound healing
   assay with or without LRRC8A knockdown was conducted using AsPC-1^GEMR
   and BxPC-3 cells as showed in [96]Figure 2f, and a transwell invasion
   assay using AsPC-1 and BxPC-3 cells with or without LRRC8A knockdown
   were performed in [97]Figure 2g. Results showed a substantial
   inhibitory effect of LRRC8A knockdown on PAAD cell migration and
   invasion ([98]Figure 2f,g). Further investigation showed LRRC8A
   knockdown resulted in the decreased protein expression of EMT markers,
   such as MMP2 in PAAD cell lines ([99]Figure 2h).

   In conclusion, the results suggest that LRRC8A plays a significant role
   in the tumorigenesis and progression of PAAD.

3.4. Co-Expression, Gene Network, and Enrichment Analysis of LRRC8A in PAAD

   The above-mentioned findings suggest that LRRC8A is a promising
   prognostic biomarker of PAAD. Therefore, it would be crucial to explore
   the potential relevance and underlying mechanisms of LRRC8A expression
   in patients with PAAD. Next, the LRRC8A co-expression and its network
   in patients with PAAD were explored, and the potential co-expression of
   LRRC8A genes was analyzed using eBioPortal. In PAAD database (TCGA,
   Firehose Legacy), the top 50 positively correlated genes of LRRC8A were
   imported to OmicShare to analyze the GO enrichment and KEGG pathways
   ([100]Figure 3). [101]Figure 3a shows that biological processes,
   including skin development, hemidesmosome assembly, epidermis
   development, tissue development, keratinocyte differentiation,
   epidermal cell differentiation, and cell junction, were associated with
   the tumorigenesis and progression of PAAD. Cell adhesion molecule
   binding, cadherin binding, protein binding involved in cell–cell
   adhesion, protein binding involved in cell adhesion, cadherin binding
   involved in cell–cell adhesion, and death receptor binding were the
   most highly enriched molecular functions, whereas adherence junction,
   anchoring junction, cell junction, membrane-bound vesicles, vesicles,
   extracellular region, and cell–substrate junction were the most highly
   enriched cellular components. Based on the KEGG pathway analysis, the
   phosphoinositide 3-kinase (PI3K)-Akt signaling pathway, focal adhesion,
   arrhythmogenic right ventricular cardiomyopathy, extracellular
   membrane–receptor interaction, and mitogen-activated protein kinase
   signaling pathway were significantly associated with the tumorigenesis
   and progression of PAAD ([102]Figure 3b). Moreover, given that LRRC8A
   co-localizes with LRRC8B–E in cells, it is necessary to analyze the PPI
   network of LRRC8A–E ([103]Figure 3c), the gene–gene interaction network
   of LRRC8A–E, and the top 50 positively correlated genes of LRRC8A
   ([104]Figure 3d).

Figure 3.

   [105]Figure 3
   [106]Open in a new tab

   Function analysis of LRRC8A in PAAD. (a) GO enrichment analysis
   (biological process, molecular function, and cellular component) of the
   top 50 positively correlated genes of LRRC8A; (b) KEGG enrichment
   analysis of the top 50 positively correlated genes of LRRC8A; (c)
   protein interaction network of LRRC8A–E; (d) gene–gene interaction
   network of LRRC8A–E and the top 50 positively correlated genes of
   LRRC8A.

3.5. Correlation of LRRC8A with Immune Infiltration

   Interestingly, the co-expression analysis of LRRC8A in PAAD samples
   showed that purinergic receptor P2Y2 (P2RY2) and ephrin-A receptor 2
   (EPHA2) showed a positive correlation with LRRC8A in most database of
   PAAD, including those of TCGA (PanCancer Atlas and Firehose Legacy),
   QCMG (Nature 2016) [[107]26], and TIMER ([108]Figure 4). P2RY2 was
   reported to enhance cancer cell glycolysis by PI3K/AKT-mammalian target
   of rapamycin (mTOR) signaling, resulting in PAAD progression [[109]27].
   However, EPHA2 was reportedly involved in multiple immunity regulation
   pathways of PAAD [[110]28,[111]29]. The mRNA expression level of EPHA2
   decreased considerably when LRRC8A was knocked down in AsPC-1^GEM-R and
   BxPC-3 cells ([112]Figure 5a). Recent studies showed that LRRC8A has a
   novel role in immune regulation [[113]20,[114]30]; therefore, whether
   its expression was correlated with immune infiltration levels using
   TIMER was investigated ([115]Figure 5b). Results showed that LRRC8A
   expression was significantly correlated with CD8^+ T cells (p = 1.83 ×
   10^−3), neutrophils (p = 1.58 × 10^−2), and dendritic cells (p = 7.88 ×
   10^−3). Similarly, a correlation analysis of LRRC8A and CD8^+ T cells
   in PAAD (179 samples) using the TISIDB database also showed that LRRC8A
   expression was significantly correlated with CD8^+ T cells (ρ = 0.181,
   p = 0.0155) ([116]Figure 5c). Further immunohistochemical results of
   pathological sections obtained from patients with PAAD showed that
   LRRC8A expression was correlated with CD8 expression ([117]Figure
   5d–f), with a correlation coefficient (R^2) of 0.83. These findings
   suggest that LRRC8A affects the patient clinical outcomes by
   interacting with immune infiltration, especially CD8^+ T cells in PAAD.
   It should be noted that LRRC8C was significantly correlated with B
   cells (p = 1.67 × 10^−7), CD8^+ T cells (p = 2.22 × 10^−16), CD4^+ T
   cells (p = 8.02 × 10^−5), macrophages (p = 7.21 × 10^−26), neutrophils
   (p = 5.30 × 10^−20), and dendritic cells (p = 3.14 × 10^−27)
   ([118]Supplementary Figure S2).

Figure 4.

   [119]Figure 4
   [120]Open in a new tab

   Correlation analysis of LRRC8A with P2RY2 and EPHA2 in PAAD. (a) LRRC8A
   showed a positive correlation with P2RY2 and EPHA2 in cBioPortal; (b)
   LRRC8A showed a positive correlation with P2RY2 and EPHA2 in TIMER.

Figure 5.

   [121]Figure 5
   [122]Open in a new tab

   Immune infiltration analysis of LRRC8A in PAAD. (a) EPHA2 expression
   decreased in BxPC3 (p * < 0.05) and AsPC1^GEM-R cells (p * < 0.05)
   after LRRC8A knockdown; (b) immune infiltration of LRRC8A in PAAD; (c)
   correlation analysis of LRRC8A and CD8^+ T cells; (d) representative
   immunohistochemical results of CD8 in patients with PAAD; (e)
   correlation analysis of LRRC8A and EPHA2 in patients with PAAD; (f)
   quantitative analysis results of [123]Figure 5d. ns: not significant.

4. Discussion

   A limitless replicative potential, sustained angiogenesis, evasion of
   apoptosis, self-sufficiency in growth signals, and insensitivity to
   anti-growth signals, tissue invasion, and metastasis are classical
   hallmarks of cancer cells [[124]12,[125]13]. VRAC, one of the most
   important chloride channels located at the cell membrane and
   constituted by LRRC8A and four other homologous family members
   LRRC8B–E, has been implicated in each hallmark of cancer [[126]31]. By
   using non-specific pharmacological VRAC blockers such as DIDS, DCPIB,
   and NPPB, VRAC was reported to be involved in the cell cycle regulation
   in human ovarian cancer, cervical cancer, nasopharyngeal carcinoma,
   small-cell lung cancer and glioblastoma [[127]14]. Moreover, VRAC
   activity has also been implicated in the migration and multi-drug
   resistance in multiple cancers. In particular, VRAC current was record
   in pancreatic duct adenocarcinoma cell lines [[128]32]. Hence, VRAC
   represents an emerging therapeutic target of PAAD. As the component of
   VRAC, LRRC8A–E was reported to be related to cancer cell proliferation,
   metastasis, and multidrug resistance in some studies, suggesting that
   LRRC8A–E may be the specific molecular regulated tumor progression
   [[129]14]. However, the biological function and prognostic value of
   LRRC8A–E in PAAD have not been well-characterized.

   In this study, the expression of LRRC8A–E in pan-cancer was explored
   using independent datasets in ONCOMINE and TCGA data in GEPIA. LRRC8A
   expression was higher in PAAD tissues than that in normal tissues, and
   it increased as PAAD progressed. Cell experiments in vitro also
   confirmed the high expression of LRRC8A in PAAD cells. The
   immunohistochemical results of pathological sections obtained from
   patients with PAAD also demonstrated that the high expression of LRRC8A
   was associated with a higher tumor grade of PAAD. Moreover, a high
   LRRC8A expression in patients with PAAD was significantly associated
   with worse clinical outcomes based on the results obtained using GEPIA
   and Kaplan–Meier plotter. Fortunately, two research groups almost
   simultaneously reported that LRRC8 heteromers were essential components
   of VRAC, and LRRC8A is an indispensable VRAC subunit. Therefore, the
   critical role and molecular mechanisms of LRRC8A in cancer management
   need further clarification [[130]33,[131]34].

   Because proliferation, migration, invasion, and drug resistance are the
   main hallmarks of cancer cells, whether LRRC8A knockdown can inhibit
   the migration, invasion, and drug resistance of PAAD cells in vitro was
   further investigated. The wound healing assay, transwell invasion
   assay, and drug sensitivity assay demonstrated the inhibitory effects
   of LRRC8A knockdown, suggesting its potential as a therapeutic target
   in PAAD. Then, the functions of LRRC8A were investigated using the
   co-expression module of eBioPortal and GO enrichment analysis. The KEGG
   pathway enrichment analysis was conducted to explore the probable
   mechanisms in PAAD. The neighboring genes of LRRC8A were mainly
   enriched in the PI3K-AKT pathway and focal adhesion pathway. A previous
   study found that PI3K/AKT was a downstream signal responsible for the
   regulatory effects of LRRC8A in cancer cell proliferation [[132]18].
   The LRRC8A-PI3K/AKT-mTOR pathways can also regulate the migration of
   esophageal squamous cell carcinoma [[133]17].

   More importantly, EPHA2 showed a positive correlation with LRRC8A in
   most studies of PAAD, and its knockdown resulted in a decrease in EPHA2
   expression, which was demonstrated to be involved in anti-tumor
   immunity by regulating prostaglandin-endoperoxide synthase. Moreover,
   LRRC8A is essential for T cell development [[134]35], and it has been
   recently reported to play an integral role in tumor immunotherapy
   [[135]20,[136]30]. Heteromeric VRAC channels composed of LRRC8A and
   either LRRC8C or LRRC8E can transport cGAMP into bystander cells to
   activate innate immune cGAS–cGAMP–STING pathway in vascular epithelial
   cells and murine macrophages. The immune infiltration findings in TIMER
   also suggested that LRRC8A affects patient clinical outcomes by
   interacting with immune infiltration in PAAD. However, immune
   infiltration analysis also showed that LRRC8C was significantly
   correlated with the infiltration levels of various immune cells. It was
   speculated that heteromeric LRRC8A/C channels mediate cGAMP transport
   and p53 signaling in T cells [[137]36].

5. Conclusions and Prospects

   In conclusion, LRRC8A can affect the prognosis of PAAD and was
   correlated to cell proliferation, cell migration, drug resistance, and
   immune infiltration. Specifically, functional analysis indicated that
   LRRC8A influences the progression and prognosis of PAAD via the
   regulation of CD8^+ T cells immune infiltration. We hope that our
   results provide novel insights into assisting in the designing of new
   therapeutic drugs for PAAD.

Supplementary Materials

   The following supporting information can be downloaded at:
   [138]https://www.mdpi.com/article/10.3390/cancers14225526/s1,
   Supplementary Figure S1: bioinformatic analysis of LRRC8B–E in PAAD;
   Supplementary Figure S2: immune infiltration analysis of LRRC8B–8E in
   PAAD; File S1: the whole western blots.
   [139]Click here for additional data file.^ (7.4MB, zip)

Author Contributions

   Conceptualization, R.X. and C.S.; methodology, Y.H.; validation, Q.X.,
   H.Z. and H.S.; data curation, C.Z.; writing—original draft preparation,
   R.X.; writing—review and editing, X.W.; visualization, Y.Z.; funding
   acquisition, R.X. and C.S. All authors have read and agreed to the
   published version of the manuscript.

Institutional Review Board Statement

   Tumor specimens were obtained with the consent of the patients and all
   human specimen experiments were approved by the Medical Ethics
   Committee of Xijing Hospital (No. 2015432).

Informed Consent Statement

   Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

   Authors declared that all and the other data supporting the findings of
   this study are available within the paper. The raw data that support
   the findings of this study are available from the corresponding author
   upon reasonable request.

Conflicts of Interest

   The authors declare no conflict of interest.

Funding Statement

   This study was supported by the National Natural Science Foundation
   Program of China (Grant No. 32070532) and Natural Science Foundation of
   Shaanxi Province (Grant No. 2022JQ-771; 2021PT-037).

Footnotes

   Publisher’s Note: MDPI stays neutral with regard to jurisdictional
   claims in published maps and institutional affiliations.

References