ABSTRACT

   Intestinal microbiota dysbiosis is a well established characteristic of
   ulcerative colitis (UC). Regulating the gut microbiota is an effective
   UC treatment strategy. Berberine (BBR), an alkaloid extracted from
   several Chinese herbs, is a common traditional Chinese medicine. To
   establish the efficacy and mechanism of action of BBR, we constructed a
   UC model using healthy adult shorthair cats to conduct a systematic
   study of colonic tissue pathology, inflammatory factor expression, and
   gut microbiota structure. We investigated the therapeutic capacity of
   BBR for regulating the gut microbiota and thus work against UC in cats
   using 16S rRNA genes amplicon sequencing technology. Our results
   revealed that dextran sulfate sodium (DSS)-induced cat models of UC
   showed weight loss, diarrhea accompanied by mucous and blood,
   histological abnormalities, and shortening of the colon, all of which
   were significantly alleviated by supplementation with BBR. A 16S rRNA
   gene-based microbiota analysis demonstrated that BBR could
   significantly benefit gut microbiota. Western blot, quantitative PCR,
   and enzyme-linked immunosorbent assays (ELISAs) showed that in
   DSS-induced cat models, the expression of the inflammatory factors was
   increased, activating the JAK2/STAT3 signaling pathway, and treatment
   with BBR reversed this effect. The myosin light chain (MLC)
   phosphorylation in the smooth muscle of the intestines is associated
   with motility of inflammation-related diarrhea in cats. This study used
   gut flora analyses to demonstrate the anti-UC effects of BBR and its
   potential therapeutic mechanisms and offers novel insights into the
   prevention of inflammatory diseases using natural products.

   IMPORTANCE Ulcerative colitis (UC) is common in clinics. Intestinal
   microbiota disorder is correlated with ulcerative colitis. Although
   there are many studies on ulcerative colitis in rats, there are few
   studies on colitis in cats. Therefore, this study explored the
   possibility of the use of BBR as a safe and efficient treatment for
   colitis in cats. The results demonstrated the therapeutic effects of
   BBR on UC based on the state of the intestinal flora. The study found
   BBR supplementation to be effective against dextran sulfate sodium
   (DSS)-induced colitis, smooth muscle damage, and gut microbiota
   dysbiosis.

   KEYWORDS: gut microbiome, ulcerative colitis, intestinal smooth muscle,
   host-bacterial interactions

INTRODUCTION

   Ulcerative colitis (UC), the most common type of inflammatory bowel
   disease (IBD), is a global public health concern ([34]1). It develops
   via the convergence of environmental, microbial immunological, and
   genetic factors ([35]2). As a primary form of IBD, UC mainly involves
   the rectum, extends to the entire colon, and affects the colonic mucosa
   and submucosa ([36]3). Maintaining the structure and producing
   peristaltic and segmental movements of the smooth muscle is essential
   for the intestine ([37]4). Intestinal microbiota disorder is an
   important risk factor for UC ([38]5, [39]6). In recent years,
   increasing evidence has indicated that intestinal flora plays a vital
   role in the progression of colitis ([40]7[41]–[42]9). Thus, the
   reshaping of the intestinal microflora is a potential target in UC
   treatment intervention strategies.

   Antibiotics, as the primary clinical treatment for the intestinal
   inflammation, may lead to disorders involving the intestinal flora of
   the organism and may generate drug-resistant genes, making the
   prevention and treatment of the disease more difficult ([43]10).
   Berberine (BBR), as one of the most common traditional Chinese
   medicines, is an alkaloid extracted from several Chinese herbs. It has
   been widely used as an antidiarrheal medication and an effective remedy
   for metabolic disorders ([44]11) and also has substantial antioxidant,
   antiinflammatory, antihyperglycemic, and hypolipidemic effects
   ([45]12[46]–[47]15). Several studies have shown that BBR has a
   significant effect on the bioavailability of nutrients in the
   intestine, which suggests that it may impact on the gut microbiome
   ([48]16[49]–[50]18). Studies have shown that BBR attenuates dextran
   sulfate sodium (DSS)-induced inflammation in rats by downregulating the
   JAK2/STAT3 pathway ([51]19[52]–[53]21). NLRP3, an essential component
   of innate immunity, is activated and can regulate the caspase-1
   activity, contributing to the activation of cytokine precursor
   pro-interleukin-1β (pro-IL-1β) and pro-IL-18 in DSS-induced models
   ([54]22[55]–[56]24). The mechanisms responsible for the link between
   the beneficial effects of BBR on colitis and gut microbiota are not
   fully understood. Although many previous studies have shown that BBR
   caused alterations in the intestinal flora of mice with inflammation
   ([57]25[58]–[59]28), intestinal infections in cats are more common and
   receive an increasing degree of attention in clinical practice, which
   increases the value of studying intestinal diseases in cats. Dextran
   sulfate sodium (DSS) has been used widely to generate an experimental
   model of UC disease. The clinical phenotype of the animal model shares
   a high similarity with that of patients with UC ([60]5,
   [61]29[62]–[63]31).

   Our study investigated the effects of BBR on the interactions between
   the colon and the gut microbiota in DSS-induced cats. Comprehensive
   metagenomics analyses were employed to analyze the potential for
   regulating the gut microbiome with BBR. We used 16S rRNA gene
   sequencing to detect the alterations of microbiota and recognize
   differential metabolites in order to illuminate the mechanism of BBR in
   the treatment of DSS-induced cat models. Our results showed that BBR
   supplementation improves the intestinal barrier, restores gut
   microbiota, modifies the metabolic profile, and suppresses the
   JAK2/STAT3 signaling pathway. In addition, BBR ameliorates intestinal
   inflammation by restoring myosin light chain (MLC) phosphorylation in
   the intestinal smooth muscles to normal levels. Accordingly, our data
   suggest that BBR has significant potential to alleviate UC.

RESULTS

BBR attenuated DSS-induced colitis.

   Our results showed that the induction of DSS caused typical UC symptoms
   in cats, such as diarrhea and hematochezia ([64]Fig. 1B), and a marked
   shift in disease activity index (DAI) score ([65]Fig. 1D) and body
   weight (Fig. S1). Additionally, the colon length of the cat was
   significantly shortened in the DSS-induced group ([66]Fig. 1C).
   Hematoxylin and eosin (HE) staining of the colon showed that DSS
   treatment caused severe enteric mucosal injury ([67]Fig. 1E). However,
   all characteristic features were prevented by oral BBR supplementation.
   These results indicate that BBR can alleviate the overall symptoms of
   DSS-induced colitis in cats and alleviate colonic injury.

FIG 1.

   [68]FIG 1
   [69]Open in a new tab

   Berberine (BBR) attenuates the symptoms of dextran sulfate sodium
   (DSS)-induced cat colitis. (A) Experimental design to test the effects
   of BBR on DSS-induced cat. (B) Diarrhea and blood conditions of
   DSS-induced colitis (DSS) group and berberine treatment (DSS+BBR)
   group. (C) Effect of DSS and BBR on colonic length. (D) Disease
   activity index of cat during colitis. (E) Representative images of
   hematoxylin and eosin (HE)-stained colon tissue samples. The data are
   expressed as means ± standard error of the mean (SEM) (n = 4). *,
   P < 0.05; **, P < 0.01.

Regulation by BBR in intestinal flora in DSS-induced UC cats.

   Species accumulation curves were shown in order to judge whether the
   sample numbers were sufficient (Fig. S2). Next, we analyzed the
   differences in intestinal flora at the family and genus levels
   ([70]Fig. 2A and [71]B). At the family level, Prevotellaceae,
   Lachnospiraceae, Selenomonadaceae, Veillonellaceae, and
   Lactobacillacrae were significant in the control group, and in the
   DSS-induced group, there was an increase in the richness of
   Bacteroidaceae and Fusobacteriaceae. After treatment with BBR, there
   was an increase in beneficial bacteria, such as Lactobacillacrae and
   Prevotellaceae and a reduction in the richness of Bacteroidaceae. At
   the genus level, the DSS-induced group showed an increase in the
   richness of Bacteroides and Fusobacterium, and after treatment with
   BBR, there was an increase in beneficial bacteria, such as
   Lactobacillus and Prevotella and a reduction in the richness of
   Bacteroides. The results showed that the intestinal flora of
   DSS-induced colitis is changed by BBR treatment.

FIG 2.

   [72]FIG 2
   [73]Open in a new tab

   Comparative structural and species analysis of gut microbiota in BBR
   cats. (A, B) Taxonomic analysis of microbiota in fecal samples at the
   top 20 family levels (A) and genus levels (B) between control group
   (CON), DSS-induced colitis (DSS) group, and berberine treatment
   (DSS+BBR) group.

Effects of BBR on intestinal flora diversity of cats.

   β-Diversity analysis is mainly used to analyze differences between the
   groups. Using a principal-component analysis (PCA) and a principal
   coordinates analysis (PCoA), differences in species composition
   abundance were compared by analyzing the projected distances on the
   axes among the samples. PCA ([74]Fig. 3A) and PCoA analyses
   ([75]Fig. 3B) were used to evaluate the similarities and differences
   between the three groups. PCA indicated that intestinal flora diversity
   was higher in the DSS-induced group than in the control group and was
   reduced after treatment with BBR. PCoA indicated that the gut
   microbiota composition of the BBR group was different from the DSS
   group in terms of axis PCo-1. These results suggest that the
   administration of BBR maintains the intestinal flora diversity.

FIG 3.

   [76]FIG 3
   [77]Open in a new tab

   Effects of BBR on intestinal flora diversity of cats. β-Diversity was
   assessed using. (A) PCA, (B) PCoA. Every point in the figure represents
   a sample, and points of different colors indicate different groups. The
   percentages of the coordinate axes are shown the influences that cause
   differences in species composition between groups.

BBR effected species differences and metabolic pathway function.

   In this study, we performed 16S rRNA gene high-throughput sequencing to
   reveal the impact of BBR on the gut microbiota. The Venn diagram is
   used as a community analysis to investigate which species are common
   and unique among different groups. It can be seen that the difference
   in operational taxonomic unit (OTU) between the DSS+BBR group and the
   DSS group at the phylum level is not apparent, mainly with Firmicutes,
   Bacteroidetes, and Proteobacteria; at the genus level, Prevotella shows
   the most evident change, followed by Bacteroides and Clostridium. There
   is a difference in relative abundance between the DSS+BBR group and the
   DSS group in the Firmicutes, Fusobacteria, and Proteobacteria. At the
   genus level, significant differences can be seen in Prevotella,
   Bacteroides, Blautia, Cellulosilyticum, and Fusobacterium in both the
   DSS+BBR and DSS groups ([78]Fig. 4A and [79]B).

FIG 4.

   [80]FIG 4
   [81]Open in a new tab

   Community analysis of DSS-induced colitis (DSS) group and berberine
   treatment (DSS+BBR) group. (A) Statistical histogram of proportion of
   relative abundance in phylum and genus of the Wayne chart. (B) Venn
   diagram of sample group amplicon sequence variants (ASV)/operational
   taxonomic unit (OTU) between three groups.

   Heat maps were used to analyze species composition so as to display the
   trend of species abundance distribution among samples and further
   compare species composition differences ([82]Fig. 5A). The Collonsella
   aerofaciens, Bifidobacterium adoiescentis, Megasphaera eisdenii,
   Bacteroides plebeius, and Lactobacillus ruminis were significant in the
   control group. The DSS-induced group showed an increase in Bacteroides
   fragilis and a reduction in Lactobacillus ruminis. After the treatment
   with BBR, there was an increase in the beneficial bacteria, such as
   Lactobacillus ruminis. A random forest analysis was used to classify
   the microbial community samples ([83]Fig. 5B). The DSS-induced group
   showed an increase in harmful bacteria, such as Bacteroides fragilis,
   and a reduction in the beneficial bacteria, such as Lactobacillus
   ruminis. However, the balance between harmful and beneficial bacteria
   was restored after treatment with BBR.

FIG 5.

   [84]FIG 5
   [85]Open in a new tab

   BBR causes species difference analysis and marker species. (A) Genus
   level species composition heat map of species. (B) Random forest
   analysis of the dominant biomarker taxa between three groups.

   The analysis of fecal flora metabolic pathways in cats allowed for
   predicting the relevant functions of their flora and analyzing the
   effect of BBR on the role of feline intestinal flora. The abundance of
   secondary functional pathways for all samples is shown in [86]Fig. 6A,
   which shows that the highest possible of metabolism-related tracks was
   observed and that human disease and genetic information processing were
   followed. [87]Fig. 6B shows multiple MetaCyc secondary functional
   pathways for all samples, which demonstrates the highest quantity of
   ways related to biosynthesis and degradation/utilization/assimilation.
   These results indicate that metabolic pathway function and species
   differences are improved after treatment with BBR.

FIG 6.

   [88]FIG 6
   [89]Open in a new tab

   BBR causes altered metabolic pathway function. (A, B) Predicted KEGG
   (A) and MetaCyc (B) secondary functional pathway analysis of
   DSS-induced colitis (DSS) group and berberine treatment (DSS+BBR)
   group.

BBR improved the symptoms of DSS-induced UC in cats through the JAK2/STAT3
signaling pathways.

   Next, we assessed the effects of BBR administration on DSS-induced
   proinflammatory responses. The DSS-induced group had significantly
   increased serum IL-1β, IL-6, and tumor necrosis factor-α (TNF-α) levels
   compared with the control group. Conversely, BBR supplementation
   remarkably reversed this tendency ([90]Fig. 7A). Exploring the
   underlying mechanism by which BBR modulates DSS-induced colitis, we
   found that the DSS-induced group showed significant increase in mRNA
   level expression of inflammatory factors. The results showed that the
   JAK2/STAT3 signaling pathways were associated with inflammation, such
   as IL-6, TNF-α, IL-1β, IL-18, NLRP3, Caspase-1, JAK2, and STAT3
   ([91]Fig. 7B). As seen in [92]Fig. 7C, the protein expressions of JAK2,
   STAT3, and other related proteins in the pathway were increased in the
   DSS group compared to the control group. The protein expressions in the
   BBR group were decreased compared to those in the DSS group. Still,
   their expressions were higher than in the control group. The above
   results demonstrate that BBR can reduce inflammation through the
   JAK2/STAT3 signaling pathway.

FIG 7.

   [93]FIG 7
   [94]Open in a new tab

   Effects of BBR on inflammatory-associated factors in DSS-induced cats.
   (A) Interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α)
   were detected using enzyme-linked immunosorbent assay (ELISA) kits. (B)
   Relative mRNA expression of inflammatory factors in the colon evaluated
   by quantitative reverse transcription PCR (qRT-PCR). (C) JAK2, STAT3,
   and other related proteins in the pathway protein expression. The data
   are expressed as the means ± SEM (n = 4) and analyzed using one-way
   analysis of variance (ANOVA) with Tukey post hoc analysis. DSS-induced
   colitis (DSS) group/ berberine treatment (DSS+BBR) group (versue
   control group [CON]). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****,
   P < 0.0001.

BBR leads to contraction of colonic smooth muscle.

   Our study showed that the Ca^2+ concentration ([95]Fig. 8A) was changed
   with the intestinal smooth muscle damage. DSS-induced models showed
   increases in Ca^2+ concentration, while the results were the opposite
   in the BBR group. Intestinal motility is positively associated with MLC
   phosphorylation in the smooth muscle. The relative activities of MLCK
   regulate smooth muscle MLC phosphorylation. The present study results
   indicated a significant increase in MLC phosphorylation in the colonic
   smooth muscle of the DSS-induced cats ([96]Fig. 8B and [97]C). However,
   these effects were significantly reversed after the BBR administration.
   The increased MLCK mRNA expression levels also changed considerably
   ([98]Fig. 8D). It is thus concluded that BBR has a substantial impact
   on colonic smooth muscle contraction.

FIG 8.

   [99]FIG 8
   [100]Open in a new tab

   Alterations of distal colon smooth muscle contraction. (A) Effect of
   BBR on Ca^2+ content in colon smooth muscle contraction. (B) Relative
   mRNA expression of smooth muscle factors in the colon evaluated by
   qRT-PCR. (C, D) The protein expression of myosin light chain (MLC), MLC
   phosphorylation (p-MLC), p-MLC/MLC, MLCK myosin light chain kinase
   (MLCK), and calmodulin (CaM) in BBR-treated DSS cat models. The data
   are expressed as the means ± SEM (n = 4) and analyzed using one-way
   ANOVA with Tukey post hoc analysis. DSS-induced colitis (DSS)
   group/berberine treatment (DSS+BBR) group (versue control group [CON]).
   *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. GAPDH,
   glyceraldehyde-3-phosphate dehydrogenase.

DISCUSSION

   IBD is a common chronic disease receiving global public health research
   attention ([101]32). UC is an atopic form of IBD with frequent
   morbidity. The development of colitis is accompanied by changes in the
   contraction of the smooth muscle of the colon. In recent years, many
   studies have focused on the relationship between UC and related
   diseases and intestinal flora ([102]33[103]–[104]35). The functions of
   the intestinal flora include aiding in the digestion of food, breakdown
   and absorption of nutrients, secretion of appropriate amounts of
   antimicrobial peptides to defend against colonization by harmful
   bacteria, and maintenance of the intestinal mucosal barrier. The impact
   of the intestinal flora on the immune system are also important
   ([105]36, [106]37). Our studies used DSS to induce UC in model cats
   because it can successfully induce high rates of stable
   colitis-associated characteristics. As expected, the cats with
   DSS-induced colitis showed various disease features comparable to those
   observed in patients with UC. The use of antibiotics and
   immune-suppressive drugs for colitis has become common, but most of
   these treatments have side effects ([107]38, [108]39). As an
   alternative, traditional plant therapy has received increasing
   attention. BBR, as an over-the-counter medicine, is readily available
   and inexpensive. Many studies have investigated the mechanism of action
   of herbal medicine in the treatment of colitis ([109]40[110]–[111]42).
   Our study found BBR supplementation to be effective against DSS-induced
   colitis, smooth muscle damage, and gut microbiota dysbiosis.

   Pathogenic intestinal microbiota plays a critical role in chronic
   inflammation. The alteration of the gut environment can lead to
   microbiota dysbiosis. Intestinal microbial composition and diversity
   are decreased in mice with colitis ([112]43[113]–[114]45). DSS changed
   the colon microbial community composition and diversity. The
   development of ulcerative colitis leads to a disturbance in the gut
   microbiota; resident bacteria are excreted in large numbers through the
   feces during diarrhea. For instance, with the highest relative
   abundance of microbiota, Bacteroidetes was increased and Firmicutes was
   decreased by DSS. The increase of Bacteroidetes and the ratio of
   Bacteroidetes/Firmicutes are the indicators of IBD ([115]17, [116]46,
   [117]47). Our results showed that BBR can decrease Bacteroidetes and
   increase Firmicutes in DSS-induced cats. BBR reshaped the microbiota
   composition by reducing the abundance of Proteobacteria. In the genus
   of bacteria, BBR can regulate the biodiversity and structure of the
   intestinal flora of cats. The richness and homogeneity of species is
   increased with the increase of beneficial bacteria and the decrease of
   harmful bacteria in the organism, such as Prevotellaceae. In the
   treatment of DSS-induced colitis with BBR, restoration of the mucosal
   barrier and the extent of the inflammatory response is improved by
   regulation of the intestinal flora.

   At the biomolecular level, BBR causes a reduction of inflammatory
   damage in the animal organism by activating inflammatory vesicle NLRP3,
   which binds to ASC. Further, the expression of inflammatory factors is
   decreased, such as IL-6, IL-18, IL-10, TNF-α, and IL-1β ([118]14,
   [119]48). IL-6 activates the downstream JAK2. The overexpression of
   IL-10 in UC mice may be due to an imbalance between proinflammatory and
   antiinflammatory cytokines due to insufficient secretion of
   antiinflammatory factors, and BBR causes changes in inflammatory
   factors through the JAK2/STAT3 signaling pathway ([120]49). Consistent
   with previous investigations, our results showed that BBR can inhibit
   inflammatory-associated mediators’ expression by dampening the
   JAK2/STAT3 signaling activation in cats with DSS-induced colitis. The
   present study results demonstrate that BBR improves the symptoms and
   inflammation in DSS-induced cats, which lays the foundation for further
   investigation of the effects of BBR on smooth muscle motility-related
   phosphorylation ([121]50). The phosphorylation of MLC regulates smooth
   muscle contractility. Motility disorders related to abnormal regulation
   of the Ca^2+ are observed in gastrointestinal inflammatory disorders
   ([122]51, [123]52). As in previous studies, our results showed that the
   increasing MLC phosphorylation in the DSS-induced cats was returned to
   normal levels by treatment with BBR, indicating that BBR benefits
   inflammation-related intestinal motility. BBR can restore intestinal
   smooth muscle function.

Conclusion.

   Our study investigated the therapeutic effects of BBR on UC based on
   intestinal flora and tissue distribution analysis. BBR plays a vital
   role in modulating intestinal flora and intestinal smoothing mechanisms
   by improving UC symptoms because of its antiinflammatory effects in
   pathological conditions. Notably, BBR tends to have unique effects that
   remain consistent when used in clinical practice. BBR has a long
   tradition as a botanical medicine for treating gastrointestinal
   disorders, and these data are expected to provide necessary information
   for the targeted application of BBR in UC treatment.

MATERIALS AND METHODS

Experimental protocol and animals.

   Nine healthy adult shorthair cats (weight, 2.0 to 2.3 kg) were randomly
   allocated into three groups: control group (CON), DSS-induced colitis
   (DSS) group, and berberine treatment (DSS+BBR) group. All experimental
   studies were conducted in accordance with the humanitarian spirit and
   in accordance with the standards of the Institutional Animal Care and
   Use Committee of Northeast Agricultural University (grant number
   NEAUEC20220340). The cats in the DSS group and DSS+BBR group were given
   5% DSS in water for 10 days. Between days 10 and 17, the DSS+BBR group
   was administered BBR (80 mg/kg/day), and the weight of each animal was
   recorded. On the day 18 of the experiment, the cats were anesthetized
   by intraperitoneal injection with pentobarbital sodium (35 mg/kg)
   before samples of tissues and blood were collected. Colon samples were
   harvested and stored at −80°C for further experiments. The animals were
   housed under standard conditions and received humane care complying
   with institutional guidelines. The experimental design used to test the
   effects of BBR on DSS-induced cats is shown in [124]Fig. 1A.

Disease activity index (DAI) measures.

   DAI is a comprehensive score that has been used to evaluate the
   severity of DSS-induced colitis in animal models, including general
   health condition, weight loss, stool consistency, and degree of fecal
   bleeding ([125]30). The scoring is as follows: score 0 indicates no
   weight loss, average stool properties, negative occult blood test;
   score 1 indicates a weight loss of 1 to 5%, soft stool, and negative
   occult blood test; score 2 indicates a weight loss of 5 to 10%, pale
   stool, and positive occult blood test; score 3 indicates a weight loss
   of 10 to 15%, diarrhea, and positive occult blood positive test; and 4
   points indicates a weight loss of >15%, diarrhea, and bloody stools.
   From days 10 to 17, the general health condition, weight loss, stool
   consistency, and degree of fecal bleeding of the three groups was
   recorded.

16S rRNA gene sequencing study and bioinformatics analysis.

   Fecal samples were collected from the three groups, and the fecal
   microbiomes were examined using 16S rRNA gene sequencing carried out by
   the Shanghai Personalbio Biotechnology Corp. The total genomic DNA was
   extracted according to the manufacturer’s protocol. The DNA
   concentration and purity were tested using Nanodrop and 1% agarose gel
   electrophoresis. Pfu high fidelity DNA polymerase was used for PCR
   amplification, and the number of amplification cycles was strictly
   controlled. The amplified products were purified and recovered by
   magnetic beads. The recovered effects were amplified by PCR and
   quantified by fluorescent light. The fluorescent reagent was Quant-iT
   PicoGreen dsDNA assay kit, and MiSeq was used to perform
   high-throughput sequencing. Analysis was performed using QIIME2
   software. The α-diversity in each sample was assessed based on the
   distribution of the amplicon sequence variants (ASV)/OTU in the
   different models. The Kyoto Encyclopedia of Genes and Genomes (KEGG)
   pathway enrichment analysis was conducted using tools available in the
   KEGG database. The OTUs reached a 97% nucleotide similarity level.

Quantitative reverse transcription PCR.

   Total RNA was extracted from colon tissue and reversing transcription
   were performed. The cDNA was synthesized using standard procedures. The
   primers used to amplify related genes are designed by the software
   Primer 5.0. The mRNA expression of colonic TNF-α, IL-6, IL-10, IL-1β,
   IL-18, NLRP3, Caspase-1, JAK2, STAT3, MLC, MLCK, and calmodulin (CaM)
   was quantified by applying Light Cycler technology and SYBR green PCR
   core reagent kits. The relative changes in the gene expression were
   analyzed according to the 2^−ΔΔCT method. Primers used for quantitative
   PCR (qPCR) in [126]Table 1.

TABLE 1.

   Primers used for quantitative PCR[127]^a
   Species       Gene            Primer (5′ to 3′)
   Cat     TNF-α     Forward CACATGGCCTGCAACTAATCA
                     Reverse CAGCTTCGGGGTTTGCTAC
           IL-6      Forward GACTCCAGCCATGACCTTCC
                     Reverse GGGTAGGGAAAGCAGTAGCC
           IL-10     Forward AAACAGCACGTGAACTCCCT
                     Reverse AGAAATCGATGACAGGCGCC
           IL-1β     Forward AACCAACAAGTGGTGTTCCG
                     Reverse GTAGGGTGGGTTTCCCGTCT
           IL-18     Forward TGACTGTACAGATAATGCACCCC
                     Reverse GCCAGACCTCTAGTGAGGCTA
           NLRP3     Forward GAGGAGGAAGAGGAGGAGGAAGTG
                     Reverse AAGGCTAACAGTGAGATGGCAGTTC
           Caspase-1 Forward TCAGGAGGAGGGCTGGTCTA
                     Reverse TGTTTCACCACCTCGTATCCC
           JAK2      Forward CGAGACCCGACACAGTTTGAAGAG
                     Reverse CACATCTCCACACTGCCAAAATTGC
           STAT3     Forward GAGAAGGACATCAGCGGCAAGAC
                     Reverse GAGATAAACCAGCGGAGACACGAG
           β-Actin   Forward CCTGGCACCTAGCACAATGA
                     Reverse CCTGCTTGCTGATCCACATC
   [128]Open in a new tab
   ^a

   IL, interleukin; TNF-α, tumor necrosis factor-α.

ELISA.

   Cat colon tissues were homogenized in ice-cold phosphate-buffered
   saline (PBS) and centrifuged at 13,000 × g at 4°C for 20 min. The
   supernatant was collected to analyze the concentrations of secretory
   immunoglobulin. IL-6, IL-1β, and TNF-α in the serum were measured with
   the corresponding enzyme-linked immunosorbent assay (ELISA) kits
   (Nanjing Jiancheng Bio, Inc., China) and measured using a microplate
   reader (Bio-Rad, Hercules, CA, USA) at 450 nm. All steps were completed
   according to the manufacturer’s instructions.

Cytosolic Ca^2+ measurements.

   Tissue homogenization was done as described above ([129]53). Calcium
   ions in the sample were combined with Methyl Thyme Aroma Blue (MTA) in
   an alkaline solution to form a blue complex. We measured the calcium
   content of the samples according to the calcium standard curve. The
   expression of Ca^2+ in the colon tissues was measured with the
   corresponding kits (Nanjing Jiancheng Bio, Inc., China, C004-2-1). All
   steps were completed according to the manufacturer’s instructions.

Western blotting.

   The colon tissue (0.1 g) was ground with liquid nitrogen for Western
   blot analysis. The protein samples were subjected to SDS-polyacrylamide
   gel electrophoresis with a concentration of 12%,10%, and 8% separation
   gels. Then, the proteins were transferred to a polyvinylidene fluoride
   membrane at 250 mA in a Tris-glycine buffer. Subsequently, the
   membranes were blocked with 5% fat-dry milk at 37°C for 2 h in the
   shaker, incubated overnight with diluted primary antibodies against the
   cat, including NLRP3, ASC, Caspase-1, JAK2, STAT3, smooth muscle
   contraction-associated speck-like protein containing MLC, p-MLC, CaM,
   and MLCK at 4°C. The membrane was incubated with secondary antibodies
   for 2 h (horseradish peroxidase-conjugated goat antirabbit IgG,
   1:1,000, CST, 7074). The protein bands were detected and quantified
   using gel imaging system software (TransGen Biotech Co., Beijing,
   China). β-Actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
   were used as internal references. Antibodies information for Western