Abstract

Background

   The intestinal tract serves as a critical regulator for nutrient
   absorption and overall health. However, its involvement in
   anti-parasitic infection and immunity has been largely neglected,
   especially when a parasite is not transmitted orally. The present study
   investigated the colonic histopathology and functional reprogramming in
   mice with intraperitoneal infection of the larval Echinococcus
   granulosus (E. granulosus).

Results

   Compared with the control group, the E. granulosus–infected mice
   exhibited deteriorated secreted mucus, shortened length, decreased
   expression of tight junction proteins zonula occludens-1 (ZO-1), and
   occludin in the colon. Moreover, RNA sequencing was employed to
   characterize colonic gene expression after infection. In total, 3,019
   differentially expressed genes (1,346 upregulated and 1,673
   downregulated genes) were identified in the colon of infected mice.
   KEGG pathway and GO enrichment analysis revealed that differentially
   expressed genes involved in intestinal immune responses, infectious
   disease-associated pathways, metabolism, or focal adhesion were
   significantly enriched. Among these, 18 tight junction-relative genes,
   44 immune response-associated genes, and 23 metabolic genes were
   annotated. Furthermore, mebendazole treatment could reverse the colonic
   histopathology induced by E. granulosus infection.

Conclusions

   Intraperitoneal infection with E. granulosus induced the pathological
   changes and functional reprogramming in the colon of mice, and
   mebendazole administration alleviated above alternations, highlighting
   the significance of the colon as a protective barrier against parasitic
   infection. The findings provide a novel perspective on host-parasite
   interplay and propose intestine as a possible target for treating
   parasitic diseases that are not transmitted orally.

   Keywords: larval E. granulosus , colon, transcriptomics, immune
   response, metabolic reprogramming

Introduction

   The intestinal tract serves as a critical regulator for nutrient
   absorption and overall health ([43]1–[44]3). Recent advances in
   immunometabolism reinforce the importance of intestinal homeostasis in
   maintaining host immune and metabolic balance, thereby highlighting the
   potential of intestine serves as a therapeutic target for many diseases
   ([45]4, [46]5). To avoid the intrusion of pathogenic component, the
   intestine establishes a complicated physical and chemical barrier
   function ([47]6, [48]7), including production of mucus by goblet cells,
   expression of tight junction proteins by intestinal epithelial cells
   ([49]8), and Paneth cell–derived antimicrobial peptides ([50]3). It is
   well established that gut barrier dysfunction usually initiates from
   intestinal component deficiency ([51]4, [52]9), characterized by
   increased permeability and impaired defense function. Leaky gut
   provides a gateway for intestinal and extra-intestinal substance to
   crosstalk, especially luminal pathogens and antigenic molecules ([53]7,
   [54]10). For example, hyper-translocation of bacterial
   lipopolysaccharide (LPS, endotoxin) into the blood circulation may
   trigger immune response resulting in upregulation of pro-inflammatory
   cytokines-related mRNA expression ([55]7, [56]9). Therefore, the
   optimal intestinal immune response guarantees the proper immediate
   environment for host immunometabolism, reducing inflammation and
   improving intestinal barrier integrity ([57]3, [58]11).

   Parasites, a major kind of pathogens obtaining nutrients from the
   hosts, have been reported to affect host immune and metabolism in
   subtle ways ([59]12–[60]14). It is documented that N. americanus
   hookworms infection may influence mucosal immune response via damaging
   gut barrier intact and inducing parasite-specific immunosuppression
   ([61]15). Since intestine is regarded as the largest immune organ in
   the body, intestinal-parasite relationships have grown to be a novel
   topic of parasitic research in recent years ([62]16–[63]18).
   Delineating host immunity against parasites and how parasites escaping
   immune attack is of obvious importance to human well-being ([64]14).
   However, the majority of studies focus on orally infected parasites;
   the function of intestinal tract in non-orally transmitted parasites
   infection has been largely neglected.

   Echinococcus granulosus (E. granulosus) is a representative helminth of
   medical importance as the pathogen of cystic echinococcosis (CE),
   widely known for its high host adaptability and worldwide distribution
   ([65]19). Emerging evidence indicates that the parasite has evolved
   novel strategies to subvert host immune responses ([66]12). Our
   previous studies revealed that E. granulosus infection disturbs lipid
   metabolism, resulting in a decrease in subcutaneous fat and reduced
   adipocytes size ([67]20). Moreover, the excretory-secretory products
   (ESPs) derived from the E. granulosus could induce the differentiation
   of immunosuppressive cells to downregulate the immunity against
   parasitic infection ([68]12, [69]13, [70]21). In previous studies,
   orally infected model was widely employed to investigate E.
   granulosus-associated intestinal alternations ([71]22, [72]23).
   However, the impact of E. granulosus infection on intestine during
   non-oral transmission remains elusive.

   In the present study, using a non-oral transmission model of the E.
   granulosus by intraperitoneal injection of protoscoleces (PSCs) to
   mice, we evaluated the effects of E. granulosus infection on colonic
   pathology and functional reprogramming. The pathological changes of
   colon were analyzed by colonic barriers function. The functional
   reprogramming of colon was examined by RNA sequencing. Meanwhile,
   mebendazole (MBZ), a priority drug of CE ([73]24), was administrated to
   evaluate the function of intestinal tract during E. granulosus
   infection. Our finding indicates a neglected role of intestine immune
   and metabolic homeostasis in the pathogenesis of larval E. granulosus.

Materials and methods

Parasite preparation

   The PSCs of E. granulosus (EgPSC) were acquired from hydatid cysts of
   sheep naturally infected with E. granulosus as described previously
   ([74]13). The non-oral transmission model of the E. granulosus were
   performed as we mentioned before ([75]25). Briefly, the EgPSC from
   naturally infected sheep were washed with PBS for three times and
   resuspended in sterile saline supplemented with penicillin (100 μg/ml,
   Beyotime Biotech, Beijing, China) and streptomycin (100 U/ml, Beyotime
   Biotech, Beijing,China).

Animal studies

   Female C57BL/6J mice aged 6 weeks were purchased from Shanghai
   Laboratory Animal Center (SLAC, Shanghai, China) and maintained in the
   Experimental Animal Center of Xuzhou Medical University with a
   conditional environment (12h light/12h dark cycle, free access to water
   and food). The protocols of all animal care and experiments were
   authorized by the Laboratory Animal Welfare and Ethics Committee
   (LAWEC) of Xuzhou Medical University (Xuzhou, China, SCXK [Su]
   2020–0048). For detecting the influence of E. granulosus infection on
   intestine, mice were randomly assigned to two groups (n = 6 per group)
   (1): mice intraperitoneally injected with 200 μl of sterile saline as
   the control group and (2) mice intraperitoneally injected with 200 μl
   of sterile saline containing 2000 living EgPSC as the infected group.
   For investigation of MBZ’s effect on intestine in infected mice, mice
   were randomly assigned to three groups (n = 6 per group): (1) mice
   intraperitoneally injected with 200 μl of sterile saline for 15
   consecutive days as the control group, (2) mice intraperitoneally
   injected with 200 μl of sterile saline for 14 consecutive days post–E.
   granulosus infection as the infected group, and (3) mice
   intraperitoneally injected with 12.5 mg/kg MBZ (Sigma-Aldrich, St.
   Louis, MO, United States) for 14 consecutive days post–E. granulosus
   infection as the treated group. Seven months after infection, mice were
   anesthetized with chloral hydrate, and the colonic tissues were
   collected for further analysis.

Periodic acid-Schiff staining

   Periodic acid-Schiff (PAS) staining was performed according to the
   established protocol ([76]26). Briefly, paraffin-embedded colonic
   tissues were cut into 5-μm sections and oxidized in 0.5% periodic acid
   for 5 min after de-paraffinization. Slides were then rinsed in
   distilled water, placed in Schiff reagent, counterstained in Mayer’s
   hematoxylin, mounted onto slides and then visualized microscopically.
   The amounts of PAS-positive cells (goblet cells) per colonic crypt were
   counted in at least 10 randomly selected PAS-stained crypts with
   sagittal orientation ([77]27).

Transcriptome profiling

   Fresh colonic samples of three control and three infected mice were
   collected to analyze the whole profile of transcriptome. Sequencing and
   data analysis were conducted in CapitalBio Technology Co., Ltd.
   (Beijing, China). Total RNA was extracted from each sample using Trizol
   reagent kit (Invitrogen, Carlsbad, CA, USA) according to the
   manufacturer’s instruction. Then, the total mRNA was enriched by Oligo
   (dT) magnetic beads. The mRNA sequences were fragmented into debris by
   using fragmentation buffer and reverse-transcribed into first-strand
   cDNA, following by second-strand cDNA amplification by polymerase chain
   reaction (PCR). The ligation debris were size selected by agarose gel
   electrophoresis and amplified and sequenced by using Illumina HiSeqTM
   2500 platform. DESeq2 was used to determine the gene expression
   differentiation between samples and obtained a P-value. Corrected
   P-value (q-value) was calculated by correcting using BH method. P-value
   or q-value was used to conduct significance analysis. Parameters for
   classifying significantly differentially expressed genes (DEGs) are ≥
   two fold differences (|log[2]FC| ≥ 1, FC: the fold change of
   expressions) in the transcript abundance and q < 0.05 ([78]28, [79]29).

Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analysis

   The Gene Ontology (GO) analysis was performed to identify the potential
   biological functions based on the different expression level of mRNAs.
   Three parts were involved in the GO terms, including biological process
   (BP), cellular component (CC), and molecular function (MF).
   Additionally, the Kyoto Encyclopedia of Genes and Genomes (KEGG)
   pathway analysis was also conducted to forecast the possible signal
   pathways via analyzing the distinctively expressed genes.

Quantitative reverse transcription polymerase chain reaction

   Quantitative reverse transcription PCR (qPCR) was conducted to verify
   the transcriptome results. The exact procedure was described in the
   previous study ([80]4). In brief, total RNA was extracted from
   homogenized colonic tissues in TRIzol^® (Vazyme Biotech Co., Ltd.,
   Nanjing, China). One-microgram purified RNA of each sample was firstly
   reverse-transcripted to cDNA using a High-Capacity cDNA Reverse
   Transcription Kit (Vazyme Biotech Co., Ltd., Nanjing, China). qPCR was
   performed using LightCycler^® 480 II Real-time PCR Instrument (Roche,
   Swiss). All samples were repeated for three times, and the relative
   expression of related genes was normalized relative to the endogenous
   reference (β-actin) with the 2^-ΔΔCt method. Primer sequences were
   listed in [81]Table 1 .

Table 1.

   The qPCR primer sequences involved in the study.
   Primer names       Sequences (5′to 3′)
   Cldn8        Forward: GCAACCTACGCTCTTCAAATGG
                Reverse:  TTCCCAGCGGTTCTCAAACAC
   Pklr         Forward:   CCCGAGATACGCACTGGAG
                Reverse:  CGACCTGGGTGATATTGTGGT
   Cldn4        Forward:  GGAGGGCCTCTGGATGAACT
                Reverse:  GATGCTGATGACCATAAGGGC
   Cxcl12       Forward:  TGCATCAGTGACGGTAAACCA
                Reverse: CACAGTTTGGAGTGTTGAGGAT
   β-actin      Forward: AGAAGGTGGTGAAGCAGGCATC
                Reverse: CGAAGGTGGAAGAGTGGGAGTTG
   [82]Open in a new tab

Western blot analysis

   Proteins were extracted from homogenized colonic tissues of mice using
   ice-cold RIPA lysis buffer containing complete EDTA-free protease
   inhibitor cocktail and PhosSTOP Phosphatase Inhibitor as previous
   ([83]5). After centrifugation, the supernatants were collected, and
   protein concentrations were quantitated by BCA assay (Beyotime Biotech,
   Beijing, China). Forty-microgram protein of each sample were separated
   by 10% SDS-PAGE and electro-transferred onto polyvinylidene difluoride
   (PVDF) membranes (BioRad, Hercules, CA, United States). Membranes were
   blocked with 5% defatted milk and incubated with indicated primary
   antibodies at 4°C for 12h. Then, membranes were incubated with
   HRP-conjugated anti-rabbit IgG secondary antibody (#7074, CST, Boston,
   MA, United States) at room temperature for 1h. Finally, the protein
   bands were test using Clarity™ ECL Western blot substrate (1705,060,
   Bio-Rad, Hercules, CA, United States) and captured using the ChemiDoc
   Touch imaging. Primary antibodies and dilutions used were anti–β-actin
   (AC026, ABclonal Biotechnology Co., Ltd., Wuhan, China, 1:50000),
   anti-ZO-1 (ab96587, Abcam, Cambridge, United Kingdom, 1:1000), and
   anti-occludin (ab167161, Abcam, Cambridge, United Kingdom, 1:1000).

Statistical analysis

   All data in this study were calculated using the software Graphpad
   Prism 8.0 (GraphPad Software, San Diego, CA, United States) and
   presented as mean ± SEM. Statistical significance was performed using
   the unpaired tailed Student’s t-test for comparison between two groups,
   and one-way analysis of variance (ANOVA) followed by the post hoc Tukey
   test for multiple comparisons. P < 0.05 was considered statistical
   significance.

Results

The comparison of intestinal pathology between EgPSC-infected group and
control group

   To detect the effect of EgPSC infection via non-oral transmission on
   intestinal pathological changes, C57BL/6J mice were intraperitoneally
   injected with 2,000 live EgPSC. The intestinal lesions were assessed
   after 7 months post-infection. We observed that EgPSC-infected group
   exhibited shorter colon length and decreased cecum wight, compared with
   the control group (P < 0.01, [84]Figures 1A–C ). Moreover, using PAS
   staining, we found that EgPSC infection decreased the amounts of PAS^+
   cells (globet cells) in the colonic villus of mice (P < 0.001,
   [85]Figures 1D, E ). Correspondingly, we also measured the expression
   of tight junction proteins, zonula occludens-1 (ZO-1), and occludin in
   the colon of mice. The EgPSC-infected group showed lower protein levels
   of ZO-1 and occludin than those in control group (P < 0.01,
   [86]Figures 1F, G ). The results suggest that EgPSC infection causes
   colonic injury in mice.

Figure 1.

   [87]Figure 1
   [88]Open in a new tab

   The protoscoleces of Echinococcus granulosus infection disrupted
   colonic epithelial barrier function in mice. The C57BL/6J mice were
   sacrificed 7 months post infection, colonic samples were collected for
   multiple analysis. (A) The representative images of colons. (B) The
   colon length (n = 6). (C) The cecum weight (n = 6). (D) Intestinal
   goblet cells and mucus were shown by PAS staining (n = 3, scale bar:
   100 μm). (E) Number of PAS^+ cells (goblet cells) per crypt. (F, G)
   Protein expression levels of ZO-1 and occludin in the colon (n = 4 -
   6). The differences were analyzed using t-test. Values are presented as
   mean ± SEM. **P < 0.01, ***P < 0.001.

Identification and validation of genes differentially expressed in the colon
after EgPSC infection

   Following the observation of EgPSC-induced colonic disruption, we
   further characterized the transcriptomic profile in the colon of mice
   post-infection. The quality control was shown in [89]Supplementary
   Table S1 . Differentially expressed genes (DEGs) were classified
   significantly through parameters |fold change| > 2 and P < 0.05. As the
   volcano plots shown in [90]Figure 2A , there were 3,019 genes
   differentially expressed, including 1,346 upregulated genes and 1,673
   downregulated genes after EgPSC infection. Red dots represented DEGs
   significantly upregulated by EgPSC infection, whereas green dots
   indicated downregulated DEGs. Meanwhile, we randomly selected 4 DEGs
   (Cldn8, Pklr, Cldn4 and Cxcl12) for qPCR to confirm the results of
   transcriptome analysis. The similar expression trends of the genes were
   observed, as EgPSC infection upregulated the mRNA levels of Cldn8, and
   downregulated the mRNA levels of Pklr, Cldn4 and Cxcl12 ([91] Figure 2B
   ).

Figure 2.

   [92]Figure 2
   [93]Open in a new tab

   The identification and validation of differentially expressed mRNAs in
   the colonic tissues post the protoscoleces of Echinococcus granulosus
   infection. (A) The volcano plot shows the distributions of mRNAs
   between the Control and Infected group. The significantly upregulated
   and downregulated RNAs are presented as red and green dots,
   respectively, whereas the black dots represent the mRNA with no
   significant difference (n = 3). (B) qPCR validation of randomly
   selected mRNAs from the RNA-seq data (n = 4 - 6).

KEGG pathway analysis of differentially expressed genes in the colon after
EgPSC infection

   To predict the biological functions of DEGs, the pathways of DEGs were
   then analyzed by KEGG pathway enrichment analysis ([94]20). The top 30
   enriched pathways were shown in [95]Figure 3 and [96]Supplementary
   Table S2 . Of which, “Cytokine-cytokine receptor interaction
   (mmu04060)”, “Chemokine signaling pathway (mmu04062)”, “T cell receptor
   signaling pathway (mmu04660)”, “Cell adhesion molecules (CAMs)
   (mmu04514)”, “Natural killer cell mediated cytotoxicity (mmu04650)”,
   “Complement and coagulation cascades (mmu04610)” and “Primary
   immunodeficiency (mmu05340)” were considered as closely associated with
   intestinal inflammation and immune responses. In line with these, KEGG
   analysis exhibited for those genes also were found in intestinal
   infectious disease-associated pathways such as “Chagas disease
   (American trypanosomiasis) (mmu05142)”, “Amoebiasis (mmu05146)”, and
   “Staphylococcus aureus infection (mmu05150)”. Meanwhile, “Retinol
   metabolism (mmu00830)”, “Protein digestion and absorption (mmu04974)”,
   “PPAR signaling pathway (mmu03320)”, “Steroid hormone biosynthesis
   (mmu00140)”, “Fat digestion and absorption (mmu04975)”, “Starch and
   sucrose metabolism (mmu00500)”, “Drug metabolism-cytochrome P450
   (mmu00982)”, “Drug metabolism-other enzymes (mmu00983)”, “Arginine
   biosynthesis (mmu00220)”, and “Ascorbate and aldarate metabolism
   (mmu00053)” involved in metabolism were significantly enriched post
   infection. Notably, in comparison with the control mice, “Focal
   adhesion (mmu04510)” associated with cell junction were significantly
   differed after EgPSC infection.

Figure 3.

   [97]Figure 3
   [98]Open in a new tab

   KEGG analysis (top 30) of the differentially expressed mRNAs in the
   colonic tissues post the protoscoleces of Echinococcus granulosus
   infection. Rich factor is the ratio of the differentially expressed
   gene number to the total gene number in a certain pathway. The color
   and size of the dots represent the range of the P-values and the number
   of DEGs mapped to the indicated pathways, respectively. The larger the
   point, the more genes involved in this pathway.

Gene Ontology analysis of colonic differentially expressed genes after EgPSC
infection

   We next conducted GO analysis of DEGs to evaluate gene enrichment in
   BP, CC, and MF. The top 30 enrichment scores of the three terms were
   shown in [99]Supplementary Figure 1 , respectively. There were many
   DEGs associated with metabolism, immune and intestinal barrier enriched
   in terms above ([100] Figure 4 ). In detail, 15 terms related to
   immune, 10 terms associated with nucleic metabolism, and 4 terms linked
   to protein metabolism were identified in the BP terms ([101] Figure 4A
   ). Ten terms related to intestinal barrier, three terms associated with
   immune, and three terms linked with metabolism were observed in the CC
   terms ([102] Figure 4B ). Moreover, there were four terms related to
   intestinal barrier and eleven terms associated with immune found in the
   MF terms ([103] Figure 4C ). These results suggested that EgPSC
   infection induces reprogramming of intestinal barrier function and
   immunometabolic events in the colon of mice.

Figure 4.

   [104]Figure 4
   [105]Open in a new tab

   Gene Ontology (GO) Analysis of the differentially expressed mRNAs in
   the colonic tissues after the protoscoleces of Echinococcus granulosus
   infection. Go annotation of differently expressed mRNAs between the
   Control and Infected group (n = 3). (A) Biological process related to
   immune, nucleic or protein metabolism. (B) Cellular components
   connected with metabolism, immune and intestinal barrier. (C) Molecular
   function associated with immune and intestinal barrier.

Differentially expressed genes involved in tight junctions after EgPSC
infection

   Intestinal barrier plays a vital role in host defense against pathogen
   invasion, the disruption of tight junctions may cause the morphological
   changes of intestinal mucosa and the increase of intestinal
   permeability and pathogen invasion ([106]30). Thus, DEGs related to
   tight junctions are analyzed in this study. As the clustering heatmap
   shown in [107]Figure 5 , EgPSC infection significantly decreased the
   expression of Ocln, Ctnnb1, Cldn4, Actn2, Sptbn1, Pard3, Cldn23, and
   Myh14. EgPSC infection also caused the upregulation of Cgn, Epb41,
   Cldn8, Shroom3, Cask, Rab3b, Epb41l2, Csnk2b, Prkcb, and MyI12a.
   Consistently with the results in [108]Figures 1D–G , these findings
   indicated that EgPSC infection impairs the tight junction function of
   colon.

Figure 5.

   [109]Figure 5
   [110]Open in a new tab

   Clustering heatmap of differentially expressed genes related to tight
   junction organization in the colon post the protoscoleces of
   Echinococcus granulosus infection. Hierarchical clustering was
   performed as a heatmap, which shows distribution of the differential
   mRNA level between the Control and Infected groups. The color shows the
   degree to which the gene is expressed with range between -1.5 and 1.5.
   Red color means the upregulated mRNAs and blue color means the
   downregulated mRNAs.

Differentially expressed genes related to immune response after EgPSC
infection

   The morphological changes of intestinal mucosa usually link with the
   activation of immune response ([111]3). Following the observation of
   DEGs related to immune found in the GO analysis ([112] Figure 4 ), we
   profiled these DEGs caused by EgPSC infection. As the clustering
   heatmap shown in [113]Figure 6 , EgPSC infection significantly
   downregulated the expression of innate immunity moleculars (Pecam1,
   Tlr5, Ccl12, Cxcr3, Ccl9, Ccl5, Ccl3, Cxcl12, Cxcr6, Ccr10, and Ccr5),
   adaptive immunity components (Pecam1, Cxcr3, Ifi47, Flt3l, Tigit, Cd3e,
   Lepr, Cd8b1, Csf1r, Fasl, Cd4, and Cd28), immunomodulatory factors
   (Cd72, Stat4, and Csf1r), immune response moleculars (Flt3l, Mapk9, and
   Cd3e), cytokines (Il15, Il12rb1, Il2rb, and Il21r). Correspondingly,
   EgPSC-infected group showed remarkably higher level of
   inflammatory-associated mRNA expression, such as Itgam, Crk, Ifngr1,
   Chuk, Itgal, Cadm1, Il1rn, Madcam1, Thpo, Nfkb1, Nos2, Ikbkb, Hras,
   Tnfrsf11a, Rorc, and Il11ra1. These results suggested that EgPSC
   infection alters intestinal immune response in mice.

Figure 6.

   [114]Figure 6
   [115]Open in a new tab

   Clustering heatmap of differential genes associated with immunity in
   the colon post the protoscoleces of Echinococcus granulosus infection.
   Red color means the upregulated mRNAs, and blue color means the
   downregulated mRNAs.

Differentially expressed genes involved in metabolism after EgPSC infection

   Recently, growing evidence demonstrates that EgPSC infection can
   regulate metabolism and influence metabolism-related diseases ([116]22,
   [117]31). In this study, as shown in [118]Figure 7 , key genes
   associated with cancer cells metabolism (Pfkfb3, Fgfbp1, Gnas, Pfkfb4,
   Ctnnb1, and Tsta3), glucose metabolism (Pgls and Hkdc1), lipid
   synthesis (Agpat4, Pklr, and Ctnnb1), lipid hydrolysis (Enpp4), lipid
   transport (Agap2), fatty acid metabolism (Mcpt1), amino acid metabolism
   (Arg2 and Glud1), cell differentiation (Tacc1), and tissue repairment
   (Fgfbp1) were remarkably downregulated in EgPSC-infected mice. In
   addition, genes related to glycerolipid metabolism (Plpp2), glycolysis
   metabolism (Pfkp), adipocyte differentiation (Rapgef4), nucleotide
   metabolism (Entpd3), serine catabolism (Shmt1), retinol metabolism
   (Akr1b10), and lipid-grading metabolism (Pla2g4f) were upregulated
   after EgPSC infection. These results indicated that EgPSC infection
   induces intestinal metabolic reprogramming in mice.

Figure 7.

   [119]Figure 7
   [120]Open in a new tab

   Clustering heatmap of differential metabolism-related mRNAs in the
   colon post the protoscoleces of Echinococcus granulosus infection. Red
   color means the upregulated mRNAs, and blue color means the
   downregulated mRNAs.

MBZ attenuated colonic injury induced by EgPSC in mice

   MBZ is a priority drug for CE treatment. We next determined whether MBZ
   could prevent colonic impairment induced by EgPSC. We found that
   MBZ-treated group showed an increase of colon length and cecum weight,
   compared with the EgPSC-infected group (both P < 0.05,
   [121]Figures 8A–C ). Also, MBZ treatment significantly increased the
   number of PAS^+ cells (globet cells) per crypt ([122] Figures 8D, E ).
   In line with these, the decrease of ZO-1 and occludin expressions
   induced by EgPSC were remarkably recovered by MBZ (both P < 0.05,
   [123]Figures 8F, G ). Besides, the abnormal expression of Cldn8, Pklr
   and Cldn4 found in transcriptomic analysis were attenuated by MBZ,
   although there was no statistically significant increase in Cxcl12
   expression ([124] Figure 9 ).

Figure 8.

   [125]Figure 8
   [126]Open in a new tab

   MBZ attenuated colonic histopathology in mice post the protoscoleces of
   Echinococcus granulosus infection. The protective effect of MBZ on
   colonic histopathology were evaluated by various parameters. (A) The
   representative images of colons. (B) The colon length (n = 6). (C) The
   cecum weight. (D) Intestinal goblet cells and mucus were shown by PAS
   staining (scale bar: 100 μm). (E) Number of PAS^+ cells (goblet cells)
   per crypt. (F, G) Protein expression levels of ZO-1 and occludin in the
   colon (n = 4 - 6). *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 9.

   [127]Figure 9
   [128]Open in a new tab

   Mebendazole (MBZ) ameliorates abnormal gene expressions induced by the
   protoscoleces of Echinococcus granulosus infection in the colon of
   mice. qPCR was performed to verify indicated mRNA levels. (A) mRNA
   levels of Cldn8. (B) mRNA levels of Pklr. (C) mRNA levels of Cxcl12.
   (D) mRNA levels of Cldn4. *P < 0.05, **P < 0.01, ***P < 0.001.

Discussion

   Using a non-orally transmitted E. granulosus infection model by
   intraperitoneally administrating EgPSC, the present study demonstrated
   for the first time that EgPSC infection via non-oral transmission
   impairs colonic integrity and induces related immunometabolism
   reprogramming. Interestingly, we unveiled that administration of MBZ,
   the choice drug for CE treatment ([129]24), effectively ameliorates the
   colonic injury and immunometabolism reprogramming caused by the
   parasitic infection. Overall, these findings provide a novel insight
   for the function of intestinal tract in non-orally transmitted
   parasitic infection.

   As a parasite infected via the fecal-oral route, E. granulosus
   infection usually impairs the gut of host ([130]32). It’s reported that
   the orally-infected E. granulosus tightly installed in the intestine of
   dog, thereby establishing strong adhesion to crypts and impairing the
   intestinal mucus integrity ([131]33). Additionally, the parasite can
   damage the epithelial tissue barrier, then penetrate and migrate to
   other organs in the Kazakh sheep ([132]22). In the present study, we
   observed that intraperitoneally EgPSC infection reduces the colon
   length and cecum size of mice. The degeneration of globet-cell derived
   mucus indicates mucus invasion ([133]4). Here, the EgPSC-infected mice
   exhibited less globet cells (PAS^+ cells). Usually, tight junctions
   disruption is persistently observed in intestinal parasite infection
   models, since parasite-derived substances and parasite lysate could
   increase intestinal barrier permeability to facilitate parasite
   migration ([134]34). A previous finding revealed that Giardia-infected
   mice exhibits sustained damage of Tight junctions (Tjs) in jejunum
   tissues ([135]35). Here, we found that the EgPSC-infected group shows
   the decrease expression of ZO-1 and occludin. Besides, tight
   junctions-associated genes were mapped abnormal expression after EgPSC
   infection in transcriptomic analysis. For example, several classic
   tight junction related genes (Ocln and Cldn4) were significantly
   downregulated post-infection, whereas other tight junctions-relative
   genes (Cldn8, Epb41L2, Prkcb, and Shroom3) were upregulated. According
   to a previous study, Cldn8 over-expression leads to the downregulation
   of Cldn2 expression ([136]36). The hyperexpression of Epb41L2, Prkcb,
   Shroom3 are implicated in adhesion damage ([137]37–[138]39). MBZ is a
   classic chemotherapeutic agent available for CE treatment ([139]40).
   Notably, we found that MBZ treatment alleviates colonic epithelial
   barrier injury induced by EgPSC infection. These results indicated
   that, similar to orally infected model, non-orally transmitted
   infection of EgPSC also causes intestinal impairment, which can be
   reversed by MBZ administration.

   Intestinal immunity is an important line of defense for host to expel
   the infection of oral transmitted parasites ([140]41). Several studies
   have recognized the relationship between intestinal immune-related
   genes expression and CE ([141]42). For example, Kazakh sheep with E.
   granulosus infection were found higher expression level of lectins
   receptors in intestines, facilitating the capability to respond and
   eliminate orally acquired E. granulosus ([142]22). Here, we found that
   intraperitoneally EgPSC-infected mice show lower expression level of
   Stat4 and IL12rb1. It is reported that IL-12 is a key initiator of
   naïve CD4^+ T cells differentiation into T helper 1 (Th1) cells, which
   depends on CD28 engagement ([143]43). Th1 cytokines is suggested to
   induce protective immune process in E. granulosus infection ([144]31).
   Also, there are decrease expression of Th1 chemokines (Ccl3, Ccl5, Ccl9
   Ccl12, Ccr5, Cxcl12, Cxcr3, Cxcr6, and Cxcr10) and adaptive immunity
   components (Cxcr3, Ifi47, Fit3L, Tigit, Cd3e, Lepr, Cd8b1, Csf1r, Cd4,
   and Cd28) in the colon tissue of EgPSC-infected mice. In addition,
   stimulators such as pathogenic molecular can cause increased mRNA
   levels of NOS2 and enhancive NO production after the activation of
   Nfkb1 ([145]44). The alternation Nfkb1 may stimulate immune cells and
   endothelial cells and induce overexpression of pro-inflammatory
   associated factors (Ifngr1, IL1rn, and Tnfrsf11a), resulting in
   systematic inflammation and intestinal lesion ([146]9). In our study,
   some inflammatory genes were observed drastically increased in the
   colon of EgPSC-infected mice, such as Nfkb1, Nos2, Ifngr1, IL1rn, and
   Tnfrsf11a. Collectively, these results suggested that EgPSC infection
   via non-oral transmission can induce intestinal immune response.

   Immunometabolism is a frontier field of research revealing the
   relationship between metabolic pathways and host immune, or even
   overall health ([147]28). In the present study, KEGG and GO analysis
   forecasted that intraperitoneally EgPSC infection influences the
   expression of genes involved in “Metabolic pathways”, such as “Pathways
   in cancer”, “Fat digestion and absorption” and “Retinol metabolism”.
   Unlike other helminths’ carcinogenic impacts, E. granulosus infection
   was reported to serve as anticancer agent ([148]45). Consistently, we
   found that several downregulated genes associated with cancer cells
   metabolism (Pfkfb3, Fgfbp1, Gnas, Pfkfb4, Ctnnb1, and Tsta3) in the
   colon of EgPSC-infected mice, indicating that intraperitoneally EgPSC
   infection may elicit protective effect in cancer development. In the
   past decade, immunometabolism has revealed that the differentiation and
   the function of immune cells are determined by metabolic pathways
   ([149]28). As E. granulosus has restricted ability to synthesize lipids
   and needs to acquire essential lipids from its hosts ([150]20). Our
   previous study revealed that EgPSC infection can enhance lipolysis in
   the adipose tissue of mice ([151]20). Accordingly, upregulated
   lipolysis genes (Plpp2 and Pfkp) and downregulated genes of
   adipogenesis (Agpat4, Pklr, and Ctnnb1), lipid hydrolysis (Enpp4),
   lipid transport (Agap2), and fatty acid metabolism (Mcpt1) were
   identified in the colon of EgPSC-infected mice in the current study. It
   is documented that lipid molecules in the membrane of immune cells are
   essential for the activation or function of immune cells ([152]46).
   Notably, the retinol may be important in host anti-parasitic effect, as
   CE-resistant sheep exhibited significant higher level of DEGs related
   to retinol metabolism ([153]22). Our result revealed that non-orally
   transmitted E. granulosus has an effect on retinol metabolism in the
   colon tissue. Moreover, we found that numerous lipid metabolites are
   key events in the differentiation and functions of splenic CD19^+ B
   cells in mice ([154]47). Additionally, several studies have identified
   the significance of retinol in maintaining appropriate immune functions
   in hosts. Retinol-deprived cotton rats have showed higher
   susceptibility of filarial worms compared to cotton rats with
   sufficient retinal supplement. Retinol metabolism is crucially related
   to orally CE infection in Kazakh sheep ([155]22). However, in the
   present study, we detected higher expression level of retinol
   metabolism gene (Akr1b10) in the colon of non-orally EgPSC-infected
   mice compared with the control mice. The different way of establishing
   infection models may contribute to the discrepancy. Moreover, MBZ
   administration reversed EgPSC-induced metabolic changes evidenced by
   restoring colonic Pklr expression. Overall, these results suggested
   that non-orally transmitted EgPSC infection induces colonic metabolic
   remodeling in mice. However, the exact role of these metabolic
   remodeling in intestinal function requires further study.

   Similar to other intermediate hosts, E. granulosus forms the hydatid
   cysts filled with PSCs and fluids in the inner organs of human.
   Spontaneously or in a traumatic way, the cyst may rupture and the PSCs
   can establish the secondary infection over the body ([156]31). This
   would cause serious consequence to human health. Herein, we highlighted
   the significance of complete intestinal functions in defensing the
   parasite. One limitation in this study might be that we only detected
   the colonic histopathology and functional gene expression profile
   post-chronic E. granulosus infection. To better comprehend
   host-parasite interplay during secondary E. granulosus infection,
   future works should focus on the dynamics of intestinal histopathology
   and functional gene expression profile at different time points after
   infection.

Conclusions

   In summary, this study employed the EgPSC-infected mouse model to
   reproduce the reinfection situation of E. granulosus by
   intraperitoneally injecting the PSCs of E. granulosus. Notably, we
   reported, for the first time, that non-orally transmitted EgPSC
   infection caused colonic injury and immunometabolism reprogramming in
   mice, and MBZ administration alleviated above alternations, indicating
   that unblemished intestinal barrier function is of great importance in
   defensing secondary infection of E. granulosus. These findings may
   provide a novel insight for treating the reinfection of the parasite.

Data availability statement

   The datasets presented in this study can be found in online
   repositories. The names of the repository/repositories and accession
   number(s) can be found in the article/[157] Supplementary Material .

Ethics statement

   All the experimental protocols were performed in accordance with the
   recommendations of the Guide for the Care and Use of Laboratory Animals
   of the Ministry of Health (China), and approved by the Ethics Committee
   of Xuzhou Medical University (Xuzhou, China, SYXK (Su) 2020-0048).

Author contributions

   WP, XY, and HL: conceived and designed the experiments. YZ, TL, YYG,
   and DW: performed the experiments. YZ, DW, YXG, and TL: analyzed the
   data. YZ and DW: contributed reagents/materials/analysis tool. XY, WP,
   HL, ZG, LF, and FS: wrote the manuscript. All authors contributed to
   the article and approved the submitted version.

Glosarry

   E. granulosus Echinococcus granulosus
   ZO-1 zonula occludens-1
   KEGG Kyoto Encyclopedia of Genes and Genomes
   PSCs protoscoleces
   GO Gene Ontology
   MBZ mebendazole
   IEC Intestinal epithelial cells
   LPS lipopolysaccharide
   CE cystic echinococcosis
   ESPs Excretory-secretory products
   EgPSCs larval E. granulosus
   LAWEC Laboratory Animal Welfare and Ethics Committee
   PAS Periodic Acid-Schiff stain
   PCR polymerase chain reaction
   DESeq2 DESeq2 package for differential analysis of count data
   FC the fold change of expressions
   BP biological process
   CC cellular component
   MF molecular function
   qPCR quantitative reverse transcription-PCR
   PBS Phosphate Buffered Saline
   PVDF polyvinylidene difluoride
   ANOVA Analysis of variance
   SEM standard error of the mean
   DEGs differentially expressed genes
   Tjs Tight Junctions
   NO nitric oxide
   Cldn23 Claudin-23
   Sptbn1 Spectrin beta chain, non-erythrocytic 1
   Ctnnb1 Catenin beta-1
   Pard3 par-3 family cell polarity regulator
   Cldn4 Claudin-4
   Actn2 Alpha-actinin-2
   Ocln occludin
   Cask Peripheral plasma membrane protein CASK
   Prkcb protein kinase C, beta
   Myl12a myosin, light chain 12A, regulatory, non-sarcomeric
   Csnk2b Casein kinase II subunit beta
   Cldn8 Claudin-8
   Cgn cingulin
   Epb41l2 erythrocyte membrane protein band 4.1 like 2
   Shroom3 shroom family member 3
   Myh14 Myosin-14
   Rab3b RAB3B, member RAS oncogene family
   Epb41 erythrocyte membrane protein band 4.1
   Cd28 T-cell-specific surface glycoprotein CD28
   Ccr5 C-C chemokine receptor type 5
   Ccr10 C-C chemokine receptor type 10
   Cxcl12 Stromal cell-derived factor 1
   Ccl12 C-C motif chemokine 12
   Ccl9 C-C motif chemokine 9
   Ccl5 C-C motif chemokine 5
   Cxcr3 C-X-C chemokine receptor type 3
   Il12rb1 Interleukin-12 receptor subunit beta-1
   Stat4 signal transducer and activator of transcription 4
   Tlr5 toll-like receptor 5
   Cd72 B-cell differentiation antigen CD72
   Ccl3 C-C motif chemokine 3
   Ifi47 interferon gamma inducible protein 47
   Csf1r Macrophage colony-stimulating factor 1 receptor
   Mapk9 Mitogen-activated protein kinase 9
   Cd3e T-cell surface glycoprotein CD3 epsilon chain
   Cd8b1 T-cell surface glycoprotein CD8 beta chain
   Cd4 T-cell surface glycoprotein CD4
   Pecam1 platelet/endothelial cell adhesion molecule 1
   Tigit T cell immunoreceptor with Ig and ITIM domains
   Il21r Interleukin-21 receptor
   Cxcr6 C-X-C chemokine receptor type 6
   Lepr Leptin receptor
   Il15 Interleukin-15
   Il2rb interleukin 2 receptor, beta chain
   Flt3l Fms-related tyrosine kinase 3 ligand
   Thpo thrombopoietin
   Tnfrsf11a Tumor necrosis factor receptor superfamily member 11A
   Crk Adapter molecule crk
   Nfkb1 Nuclear factor NF-kappa-B p105 subunit Nuclear factor NF-kappa-B
   p50 subunit
   Ikbkb inhibitor of kappaB kinase beta
   Chuk conserved helix-loop-helix ubiquitous kinase
   Rorc Nuclear receptor ROR-gamma
   Ifngr1 interferon gamma receptor 1
   Itgal Integrin alpha-L
   Itgam integrin alpha M
   Il11ra1 Interleukin-11 receptor subunit alpha-1
   Hras GTPase HRas GTPase HRas, N-terminally processed
   Cadm1 Cell adhesion molecule 1
   Madcam1 mucosal vascular addressin cell adhesion molecule 1
   Il1rn Interleukin-1 receptor antagonist protein
   Nos2 Nitric oxide synthase, inducible
   Fasl Tumor necrosis factor ligand superfamily member 6 Tumor necrosis
   factor ligand superfamily member 6
   Pfkfb3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
   Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
   Pfkp ATP-dependent 6-phosphofructokinase, platelet type
   Fgfbp1 Fibroblast growth factor-binding protein 1
   Ctnnb1 Catenin beta-1
   Akr1b10 aldo-keto reductase family 1, member B10
   Tsta3 tissue specific transplantation antigen P35B
   Gnas GNAS (guanine nucleotide binding protein, alpha stimulating)
   complex locus
   Pla2g4f Cytosolic phospholipase A2 zeta
   Rapgef4 Rap guanine nucleotide exchange factor (GEF) 4
   Agpat4 1-acyl-sn-glycerol-3-phosphate acyltransferase delta
   Plpp2 phospholipid phosphatase 2
   Glud1 Glutamate dehydrogenase 1
   Arg2 Arginase-2, mitochondrial
   Enpp4 Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 4
   Entpd3 ectonucleoside triphosphate diphosphohydrolase 3
   Pgls 6-phosphogluconolactonase
   Pklr pyruvate kinase L/R
   Shmt1 serine hydroxymethyltransferase 1 (soluble)
   Hkdc1 Putative hexokinase HKDC1
   Tacc1 Transforming acidic coiled-coil-containing protein 1
   Mcpt1 mast cell protease 1
   Agap2 ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
   SRA Sequence Read Archive.
   [158]Open in a new tab

Funding Statement

   This work was funded by the National Natural Science Foundation of
   China (No. 81871670 and 82002164), the Natural Science Foundation of
   Jiangsu Province (No. BK20211055, BK20201459), the China Postdoctoral
   Science Foundation (No.2022M710120), the Jiangsu Qing Lan Project, the
   Priority Academic Program Development of Jiangsu Higher Education
   Institutions, and the Jiangsu Training Program of Innovation and
   Entrepreneurship for Undergraduates (Nos. 202210313070Y and
   202010313036Z). The funders had no role in study design, data
   collection, analysis, decision to publish, or preparation of the
   manuscript.

Conflict of interest

   The authors declare that the research was conducted in the absence of
   any commercial or financial relationships that could be construed as a
   potential conflict of interest.

Publisher’s note

   All claims expressed in this article are solely those of the authors
   and do not necessarily represent those of their affiliated
   organizations, or those of the publisher, the editors and the
   reviewers. Any product that may be evaluated in this article, or claim
   that may be made by its manufacturer, is not guaranteed or endorsed by
   the publisher.

Supplementary material

   The Supplementary Material for this article can be found online at:
   [159]https://www.frontiersin.org/articles/10.3389/fimmu.2022.1084203/fu
   ll#supplementary-material
   [160]Click here for additional data file.^ (711.4KB, jpeg)
   [161]Click here for additional data file.^ (9.7KB, xlsx)
   [162]Click here for additional data file.^ (20KB, xlsx)
   Supplementary Figure 1

   Gene Ontology (GO) analysis of the differentially expressed mRNAs. Go
   annotation of differentially expressed mRNAs with top 30 enrichment
   numbers of (A) biological processes, (B) cellular components, (C)
   molecular functions. The GO terms with P-value ≤ 0.05 were considered
   significant.
   [163]Click here for additional data file.^ (1.7MB, jpeg)

References